1.Study on diffusion-weighted imaging as a predictive marker for chemoradiotherapy response in cervical canc-er patients
Shunzhuang ZHANG ; Zhoupeng MA ; Yongxing MIAO ; Jianjun ZHOU
Chinese Journal of Primary Medicine and Pharmacy 2014;(9):1305-1306
Objective To observe the relationship between diffusion-weighted imaging ( DWI) characteristics and chemoradiotherapy response in recurrence patients with radical hysterectomy .Methods 26 recurrence patients with radical hysterectomy were included .All underwent conventional MRI and DWI before and after chemoradiotherapy . Baseline tumor characteristics including recurrence site ,gross tumor volume ,necrotic area and the ADC value were re-corded.Focal regions of restricted diffusion were delineated as a separate ROI and ADC value was determined .Ima-ging features were compared between complete response group and partial response group .Results 12 patients had complete response ( CR group ) ,14 patients had partial response ( PR group ) .ADC valueafter chemoradiotherapy was significantly higher than that before chemoradiotherapy in PR patients .Compared with CR group ,PR group had a grea-ter gross tumor volume ,higher ADC value and more focal regions of restricted diffusion .Recurrence type and necrotic areas was no significant differences .Conclusion ADC value and focal regions of restricted diffusion adquired by DWI help to determine chemoradiotherapy response in recurrence patients with radical hysterectomy ,which is helpful for clinicians to predic treatment effect early .It has great significance for developing reasonable programs and impro-ving the therapeutic effect .
2.Effect of propofol pretreatment on the expression of p-JNK, MMP-9 and AQP-4 during focal cerebral ischemia-reperfusion in rats
Fengtao JI ; Minghui CAO ; Jianjun LIANG ; Liping MIAO
Chinese Journal of Anesthesiology 2010;30(11):1357-1360
Objective To investigate the effect of propofol pretreatment on the expression of phosphorylated c-Jun N-terminal kinase (p-JNK), matrix metalloproteinase-9 (MMP-9) and aquaporin-4 (AQP-4) during focal cerebral ischemia-reperfusion (I/R) in rats. Methods Seventy-two healthy male SD rats weighing 250-280 g were randomly divided into 4 groups (n = 18 each): sham operation group (group S), I/R group and propofol pretreatment group (P1 and P2). In group I/R, P1 and P2, focal cerebral I/R was induced by occlusion of middle cerebralartery for 2 h followed by 24 h of reperfusion. In group P1 and P2, intraperitioneal 0.5 % and 1% propofol 10 ml/kg were injected 30 rmin before ischemia respectively. In group I/R, normal saline 10 ml/kg was given instead of propofol 30 min before ischemia. Neurological deficit score (NDS) was assessed after consciousness was recovered. 2% Evans blue (EB) 3 ml/kg was injected intravenously 1 h before the animals were sacrificed at 24 h of reperfusion. The brain tissues were taken for determination of the brain water content, EB content and expression of p-JNK, MMP-9 and AQP-4. Results Compared with group S, the NDS and content of water and EB were significantly increased and the expression of p-JNK, MMP-9 and AQP-4 was up-regulated in group I/R, P1 and P2(P < 0.05). Compared with group I/R, the NDS and content of water and EB were significantly decreased and the expression of p-JNK, MMP-9 and AQP-4 was down-regulated in group P1 and P2 (P < 0.05). Compared with group P1 , the expression of p-JNK and MMP-9 was down-regulated (P < 0.05), but no significant difference was found in the NDS, water and EB content and the expression of AQP-4 in group P2 (P > 0.05). Conclusion Propofol pretreatment can reduce focal cerebral I/R injury by inhibiting the activation of JNK signal pathway and up-regulation of MMP-9 and AQP-4 expression.
3.Effects of SSF on memory deficits in aluminum toxic mice
Yazhen SHANG ; Hong MIAO ; Jianjun CHENG ; Zhenling CAI
Chinese Pharmacological Bulletin 1987;0(03):-
Aim To study effects of total flavonoids from stems and leaves of Scutellaria baicalensis Georgi(SSF)on learning and memory deficits, automatic dyskinesia, neural and hepatic pathological changes and free radicals abnormal alterations.Methods Aluminum toxic model of mice was produced by introperitoneal injection (ip) of AlCl_3 for 50 d. Behavioral test of mice was used to examine the learning and memory ability;the number of automatic action determined the automatic dyskinesia;the neural and hepatic pathological changes were assessed by alterations of cerebral cortex and liver;MDA level and SOD activity in brain and liver were measured to evaluate free radicals.Results AlCl_3(100 mg?kg~-1 ,ip,50 d)resulted in a decreased ability of learning and memory in water maze task, lowered automatic action numbers, neuronal-hepatic-pathological changes and free radicals abnormal alterations, as compared with control group. The dose of SSF 50, 100 and 200 mg?kg~-1 significantly reversed the above pathological changes in toxic mice caused by aluminum. Conclusion SSF could reduce cognitive deficits and automatic dyskinesia, improve neuronal-hepatic-pathological changes and free radicals abnormal alterations.
4.Scutellaria barbata flavonoids inhibits NFT aggregation and regulatory mechanism in rats induced by composited Aβ
Ke GUO ; Hong MIAO ; Shusong WANG ; Jianjun CHENG ; Yazhen SHANG
Chinese Journal of Pathophysiology 2016;32(12):2147-2156
AIM: To investigate the effects of Scutellaria barbata flavonoids (SBF) on neurofibrillary tangle (NFT) aggregation, tau protein phosphorylation and the regulated mechanism of glycogen synthase kinase (GSK) 3βand protein phosphatase (PP) 2A in the rats induced by amyloid βprotein 25-35 (Aβ25-35) in combination with AlCl3 and re-combinant human transforming growth factor ( RHTGF)-β1( composited Aβ) .METHODS:The male SD rats were used to establish the simulated Alzheimer disease ( AD) model by intracerebroventricular injection of composited Aβ.The Morris water maze was applied for screening the successful model rats with learning and memory deficits .The successful model rats were daily and orally administrated with SBF at doses of 35, 70 and 140 mg/kg or positive control drug Ginkgo biloba leaves flavonoids ( GLF) at 140 mg/kg for 37 d.The silver nitrate staining was used to determine the cortical NFT .The protein levels of total tau, phosphorylated protein of tau at Ser199 and Ser214 sites, GSK3βand PP2A in hippocampus and cortex were determined by Western blot .The mRNA expression of GSK3βand PP2A in the hippocampus and cortex was detected by RT-PCR.RESULTS:Compared with sham group , the cell number of positive NFT with silver nitrate staining in model rat cerebral cortex was significantly increased .The protein levels of phosphorylated tau protein at Ser 199 and Ser214 sites, GSK3βin the hippocampus and cerebral cortex in the model rats dramatically elevated , and PP2A was marked decreased as compared with the sham group rats.Meanwhile, the mRNA expression of GSK-3βsignificantly increased but PP2A was de-creased.However, these above abnormalities were differently attenuated by treating with SBF at different doses or GLF at 140 mg/kg for 37 d.CONCLUSION: SBF suppresses the NFT aggregation by inhibition of the regulatory functions of GSK-3βand PP2A, thus reducing the phosphorylation of tau protein .
5.Intravoxel incoherent motion diffusion weighted imaging of normal adult kidney
Yuqin DING ; Xiyin MIAO ; Renchen LI ; Yingli CAO ; Mengsu ZENG ; Jianjun ZHOU
Journal of Practical Radiology 2016;32(4):558-561
Objective To analyze quantitatively intravoxel incoherent motion diffusion weighted imaging (IVIM-DWI)of normal adult kidney and to evaluate the effects of the location of the kidney,gender and age on IVIM-DWI parameters.Methods Thirty healthy adult volunteers were recruited to undergo IVIM-DWI examination.Two radiologists measured the D ,D? and f values of renal parenchyma in both the upper pole,middle part and lower pole of the kidneys separately.Results The D ,D? and f values of the middle part of kidneys in healthy adult were(1.61±0.1 6)×10 -3 mm2/s,(1 7.45 ±3.78)×10 -3 mm2/s and (26.88 ±5.1 9)%, respectively.The D values of right kidney were higher than that of left kidney (P <0.05).The f values of normal kidney in male volunteers were higher than that of female (t = 3.321,P =0.001).The D values of normal kidney in > 50 years group were lower than that of ≤50 years group (t = 3.548,P=0.001).D value of the kidney and age was negatively correlated (r=-0.406).Intraclass correlation coefficient of D,D? and f values between two observers were 0.881,0.56 and 0.741,respectively.The consistency of two observers in measurement of IVIM-DWI parameters in the middle part of kidneys was higher than that of the upper pole and lower pole of the kidneys.Conclusion The IVIM-DWI parameters of adult normal kidneys are influenced by different parts of the kidney,gender and age.
6.Research progress on irreversible tyrosine kinase inhibitors
Jianjun GUO ; Jing ZHU ; Yongyue ZHAO ; Tengfei QUAN ; Zhenyu MIAO ; Haizhi BU
Chinese Pharmacological Bulletin 2015;(6):749-754
Dysfunction in tyrosine kinase activity disrupts the nor-mal control of cellular phosphorylation signaling pathways,which plays a vital role in genesis and development of various tumors, and makes tyrosine kinases a class of targets of many anti-tumor drugs. Currently most approved tyrosine kinase inhibitors ( TKIs) are based on irreversible binding mechanisms, making them poorly selective, not potent or sustained enough regarding pharmacological effects and prone to triggering resistance. In the past decade, much progress has been made in the development of
a new class of TKIs which irreversibly inhibit their target proteins via the formation of covalent bonds, overcoming the drawbacks of irreversible TKIs. Several irreversible TKIs have entered markets or clinical research phases. This review is to summarize the structural, pharmacological and medicinal chemical properties of investigational and marketed irreversible TKIs as well as their re-cent developments.
7.Effect of Intravenous rhBNP on Regional Myocardium Deformability in Patients With Anterior Acute Myocardial Infarction After Primary Percutaneous Coronary Intervention
Yating LIU ; Yuhang WANG ; Yanbo WANG ; Miao SHI ; Jianjun CHEN ; Xinshun GU
Chinese Circulation Journal 2015;(7):650-653
Objective: To explore the effect of intravenous recombinant human brain natriuretic peptide (rhBNP) on regional myocardium deformability in patients with anterior acute myocardial infarction (AMI) after primary percutaneous coronary intervention (PCI). Methods: A total of 35 patients with anterior AMI who received primary PCI within 12 hours of symptom onset in our hospital from 2013-06 to 2013-12 were enrolled in this study and randomized into 2 groups: rhBNP group, the patients received intravenous rhBNP,n=18, Control group, the patients received standard intravenous nitrates,n=17, and the intravenous pumping administration maintained for 72 hours in both groups. The echocardiography was conducted at immediately, 7 days and 1 month after PCI respectively to compare the relative parameters. The occurrence of major adverse cardiac events (MACE) were followed-up for 6 months in all patients. Results: The baseline condition was similar between the two groups,P>0.05 , the parameters of echocardiography as LVEF and WMSI at immediately and 7 days after PCI were similar between the two groups,P>0.05. Compared with Control group, rhBNP group had the increased LVEF and decreased WMSI at 1 month after PCI ,P<0.05; rhBNP group had increased SRs at 7 days after PCI,P<0.05, while SRe and SRa were similar between the two groups,P>0.05; SRs, SEe and Sra were increased at 1 month after PCI, allP<0.05. The cTnI value in rhBNP group was lower than that in Control group as (50.09 ± 16.88) ng/ml vs (63.24 ± 18.60) ng/ml,P=0.036. The occurrence of MACE was similar between the two group,P>0.05. Conclusion: Intravenous administration of rhBNP could improve the regional myocardium deformability and the systolic/diastolic function in patients with anterior AMI after primary PCI.
8.Difference of AMI and coronary artery lesion between Uygur nationality and Han nationality in Xinjiang Dushanzi
Shuqiu QU ; Jianjun BAI ; Xinli ZHU ; Yukai WANG ; Yumei WANG ; Hongxia MIAO
Chongqing Medicine 2013;(33):4014-4016
Objective To discuss the clinical characteristics of acute myocardial infarction (AMI) and coronary artery lesion fea-tures for Uygur nationality and Han nationality in Xinjiang Dushanzi area .Methods The AMI patients during hospitalization from January 2005 to January 2012 were divide into two groups ,Group A(Uygur nationality ,n=40) and Group B(Han nationality ,n=130) ,and compared the aspects of risk factors ,morbidity situation and electrocardiogram changes etc ,carried out the coronary an-glography and analyzed the coronary artery lesion features of patients in two groups .Results The two groups of patients are male-dominated ,the AMI incidence of Uygur patients was higher than Han nationality before 60 years old(P<0 .01);More morbidities of Uygur nationality were related with the alcohol drinking (32 .5% ) ,mood disorders (40 .0% ) ,diabetes (52 .5% ) and hyperlipi-demia(72 .5% )(P<0 .01) ,and mainly coronary artery lesions were three blood vessels (P< 0 .05) .The Han nationality patients with high blood pressure have more proportion (P<0 .05) ,mainly coronary artery lesions were single blood vessel (P<0 .05) .No significant differences were observed after comparing the location of infarction and related infarction blood vessels of patients in two groups .Conclusion The onset age of Uygur AMI patients in Xinjiang Dushanzi area is younger ,and the coronary artery disease is worse .It is necessary to improve the lifestyles and change unhealthy eating habits and to carry out the active intervention in early stage .
9.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
10.Hedgehog signaling pathway inhibitor reverts acquired chemoresistance in human pancreatic cancer SW1990 cell line
Jie YAO ; Yong AN ; Jianjun QIAN ; Dousheng BAI ; Zekuan XU ; Yi MIAO
Chinese Journal of Pancreatology 2012;12(3):184-188
Objective To investigate the expression levels of hedgehog signaling pathway members (SMO,Gli1,ABCB1,ABCG2) in gemcitabine resistant pancreatic cancer cells and to study the effect of hedgehog signaling pathway inhibitor on acquired chemoresistance.Methods Human pancreatic gemcitabineresistant SW1990 cell line (SW1990/GZ) was established.Hedgehog inhibitor,cyclopamine,was used to treat resistant cells.Different expression levels of SMO,Gli1 and ABCB1,ABCG2 mRNA and proteins,and the percentage of CD44 + CD24 + and CD133 + cells were compared by quantitative RT-PCR and Western blot before and after cyclopamine treatment,respectively.Were treated with 100 μmol/L of gemcitabine SW1990/GZ cells after cyclopamine treatment,and cell apoptosis was determined by Annexin V/PI method.Results The percentage of CD44+ CD24+ and CD133+ cells in SW1990/GZ cells were increased from (29.45 ±1.99)%,(59.37 ± 1.69)% in parental cells to (93.16 ±2.46)%,(95.88 ± 1.47)% (P <0.05),respectively.The mRNA expression levels of ABCB1,ABCG2,and Gli1 were increased (274.90 ±31.44),(3.48 ±0.33),(4.15 ±0.42) folds,compared with that of parental cells.The mRNA expression of SMO was also detected in resistant cells.The results of protein expression were consisted with that of mRNA expression.After treatment of 2 μmol/L cyclopamine for 1 week,the percentage of CD44 + CD24 + and CD133 +in SW1990/GZ cells decreased to (36.68 ±2.44)% and (62.76 ± 1.28)% (P <0.05),respectively.After treatment with 2,5μmol/L of cyclopamine,SW1990/GZ cells were re-exposed to 100 μ mol/L of gemcitabine,and then the cell apoptosis and death rates were (53.68 ± 5.24 )% and (69.99 ± 3.16 )%,which were significantly higher than those in control group ( 4.55 ± 0.87 ) % ( P < 0.01 ).Conclusions G emcitabine-resistant pancreatic cancer SW1990 cells are enriched with cancer stem cells and highly express hedgehog member SMO and Glil.Inhibition of hedgehog signaling pathway by cyclopamine can reduce the proportion of cancer stem cell in gemcitabine-resistant cells,down-regulate SMO and Glil expression levels,partly restore the sensitivity to gemcitabine and reverts the acquired drug resistance.