Objective:To seek better treatments for abnormal pelvic floor muscle tension and pelvic floor dysfunction after spinal cord injury.Methods:The morphology of pelvic floor muscle fibers of rats with spinal cord injury at different levels was observed under the electron microscope. Thirty female adult Sprague-Dawley rats were randomly divided into a suprasacral (SS) cord injury group, a group with spinal cord injury at or below the sacral level (SC) and a normal group (NG), each of 10. The relevant spinal cord injury models were established in the SS and SC groups through spinal cord disconnection. Four weeks later, the pixel area of ATPase-positive fibers was used to quantify the content of type I fibers in the pubococcygeus muscle of each rat through observation under the electron microscope after hematoxylin and eosin staining.Results:The average content of type I muscle fibers in both the SS and SC group was significantly lower than in the normal group. The SC group′s average level was significantly lower than that of the SS group. Under the microscope the stained myofibers were tortuous, deformed in appearance and with proliferated nuclei. Capillary dilation could be seen locally in the SS group 4 weeks after the injury. In the SC group at 4 weeks after the injury the pubococcal fibers were seriously "dissolved" , or disordered, with spherical nuclei and mild hyperplasia. Under the electron microscope, the sarcomeres of the SC group were obviously dissolved, atrophied and broken, though the basic structure persisted, with mild mitochondrial proliferation. The sarcomeres of the SC group were extremely dissolved and broken, completely losing basic structure, with abundant connective tissue proliferation but without obvious mitochondrial proliferation.Conclusions:After suprasacral cord injury, the content of type I muscle fibers in the pubococcygeus muscle of the pelvic floor decreases somewhat, with the basic structure of the muscle fibers remaining intact. However, after spinal cord injury at or below the sacral level, type I muscle fibers decrease significantly in the pubococcygeus muscle of the pelvic floor, and the basic structure is seriously damaged.

Appendiceal mucinous adenocarcinoma is a rare disease.The preoperative diagnosis is almostly impossible due to the lack of typical symptoms and inexperienced surgeons.One patient with appendiceal mucinous adenocarcinoma was diagnosed successfully at the 210th Hospital of Chinese PLA,who was misdiagnosed as with periappendiceal abscess by other hospitals.The result of intraoperative frozen pathological section confirmed appendiceal mucinous adenocarcinoma.And then the patient received extended resection and effective recovery.

Objective To compare the effects of aspirin and clopidogrel on platelet aggregation function by TEG,and to study the antiplatelet agents tailored therapy of Thrombelastography(TEG)in treatment of cerebral infarc-tion patients.Methods 100 patients with acute cerebral infarction were included in two groups:aspirin group and clopidogrel group.The inhibitory rates of AA and ADP receptor pathway in platelets were detected by TEG.The effect of inhibitory rates in group aspirin and clopidogrel was compared with nerve function and the recurrence rate of stroke. Results The inhibitory rates of group aspirin (85.23 ±21.98)% was higher than group clopidogrel (47.31 ± 22.37)% (t =7.340,P =0.005).The patients with which the inhibitory rates showed goodby TEG in group aspirin and clopidogrel got better neurological recovery,and the patients showed goodby TEG in group aspirin got lower stroke recurrence rate within 1 year(χ2 =4.460,P =0.035;χ2 =7.232,P =0.007).Conclusion TEG had guided the antiplatelet individual therapy for cerebral infarction patients,and can be used to predict and confirm the efficacy of antiplatelet drug.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

Objective:To investigate the effect of GTPBP4 silencing by RNA interference on the radiosensitivity of esphageal cancer EC9706 cells line.Methods:The expression data of GTPBP4 in esophageal cancer tissues was obtained from public Gene Expression Omnibus (GEO) database. Recombinant plasmid-mediated RNA interference (RNAi) was employed to transfect the esophageal cancer EC9706 cell to evaluate the influence of GTPBP4 silencing on the proliferation, apoptosis and radiosensitivity of esphageal cancer EC9706 cells. The expression levels of GTPBP4 mRNA and protein and apoptosis-associated proteins of Bax, cleaved caspase-9, cleaved caspase-3 and Bcl-2 were determined by qRT-PCR and Western blot. The cell proliferation was determined by MTT assay. The changes in cell apoptosis were detected AnnexinⅤ-FITC/PI double staining flow cytometry. The variations in radiosensitivity after radiation exposure were assessed by clone formation assay.Results:The expression level of GTPBP4 in the esophageal cancer tissues was significantly higher than that in the normal adjacent esophageal tissues ( P<0.001). qRT-PCR and Western blot demonstrated that the expression levels of GTPBP4 mRNA and protein in the GTPBP4-siRNA group were significantly lower than those in the blank and negative control groups (both P<0.001), suggesting that the plasmid was successfully transfected into the EC9706 cells. MTT assay indicated that the EC9706 cell proliferation rate was significantly inhibited ( P<0.001). Flow cytometry found that the apoptosis rate was significantly increased in the GTPBP4-siRNA group ( P<0.001). After GTPBP4 gene interference combined with radiotherapy, the cell sensitivity enhancement ratio was 1.716. The apoptosis rate of EC9706 cells was significantly increased in the GTPBP4-siRNA group ( P<0.001). The expression levels of apoptosis-associated proteins including cleaved caspase-9, cleaved caspase-3 and Bax were significantly up-regulated, whereas that of Bcl-2 was significantly down-regulated in the EC9706 cells in the GTPBP4-siRNA group ( P<0.001, P=0.001, P=0.001 and P=0.005). Conclusions:GTPBP4 gene is highly expressed in human esophageal cancer tissues. RNAi technology can effectively inhibit the expression of GTPBP4 gene in the EC9706 cells, thereby suppressing cell proliferation, inducing cell apoptosis and enhancing the radiosensitivity of cells.

Objective To apply DNA barcoding technology for exploring its taxonomic status and differences in the molecular biology of Cricetulus barabensis in Shaanxi Province.Methods Sixty-five samples of Cricetulus barabensis were collected from Dingbian,Jingbian Counties in northern of Shaanxi and Dali County in Guanzhong plain (Dingbian 58 samples,Jingbian 2 samples,and Dali 5 samples).According to the mitochondrial cytochrome C oxidase subunit I gene (CO I) sequence,the genetic distance was calculated and Neighbor-Joining tree was constructed.Results The genetic distance between two samples (13.16,13.21) and other 56 samples of Dingbian was 9.2％-10.0％.The genetic distance between the 56 samples of Dingbian and Jingbian was less than 1％ and Dali was 7.2％-8.3％;the average intraspecific genetic distance of Jingbian and Dali was less than 1％.The Neighbor-Joining tree showed that all the Cricetulus barabensis samples from the three counties were separated into two large branches.The samples of 13.16,13.21 from Dingbian together were classified into a class and the rest of the samples into another separate branch.At the same time,other samples from Dingbian except 13.16,13.21 and Jingbian were distributed in a small branch,and Dali samples were occupied another small branch.Conclusion Using the DNA barcoding technology,we have determined three subspecies of Cricetulus barabensis in Shaanxi Province,Dingbian has two kinds and Dali has a different subspecies.

Objective To investigate the voiding patterns of term and preterm newborns and whether voiding in term and preterm neonates was accompanied by any cortical arousal. Methods Between May 2013 and September 2013,64 hospitalized newborns at Neonatal Intensive Cave Unit in the Frist Affiliated Hospital of Zhengzhou University were recruited in this study. In these patients,31 cases were term newborns(20 male,11 female)and 33 cases were preterm newborns(19 male,14 female). The term and preterm newborns gestational ages at birth were(38. 2 ± 1. 2) weeks and(32. 1 ± 1. 6)weeks,weighted(3. 3 ± 0. 4)kg and(1. 7 ± 0. 3)kg,respectively and postnatal ages at study were[4 - 16(10. 5 ± 3. 6)]days and[4 - 16(11. 2 ± 3. 1)]days. The voiding volume(VV),post - void residual volumes(PRV),body movement rate and voiding frequency(VF)in 4 hours as well as the volume of milk and liquid fed at the same time frame were recorded and analyzed,retrospectively. At the same time electrocardiogram(ECG)and electroencephalogram(EEG)were recorded. The changes of heart rate(HR),EEG frequency,respiratory frequency (RF)during the 5 s period and 30 s before and after voiding onset were compared respectively. For cortical arousal definition the recommendations of the International Pediatric Work Group on Arousals(2005)were used. Results A total of 184 times of voiding were recorded. In preterm newborns,the VV and body movements rate were significantly lower compared with the term newborns[(21. 8 ± 7. 9)mL and(41 ± 21)% vs(26. 4 ± 8. 7)mL and(62 ± 19)% , t = 3. 75,4. 20,all P ﹤ 0. 05]. However,the VF and PRV were significantly higher in preterm newborns[(1. 7 ± 0. 9) mL and(3. 2 ± 1. 1)times vs(1. 2 ± 0. 7)mL and(2. 6 ± 0. 9)times,t = 2. 47,2. 38,all P ﹤ 0. 05]. Bladder voiding in these infants happened only during QS. In term newborns,HR frequency was higher during the 5 s interval before and after voiding onset when compared with the 30 s period before voiding onset[(152 ± 6)times/ min and(152 ± 5) times/ min vs(147 ± 6)times/ min,t = 5. 30,5. 76,all P ﹤ 0. 05]and the EEG frequency[(2. 6 ± 0. 1)Hz and (2. 6 ± 0. 1)Hz vs(1. 5 ± 0. 1)Hz,t = 70. 0,70. 0,all P ﹤ 0. 05]. While the HR and EEG frequency of preterm neo-nate was not changed before and after bladder voiding onset. The RF of both term and preterm neonates were not changed before and after bladder voiding onset. Conclusions The voiding patterns between term and preterm were sig-nificantly different and cortical arousal was found only in term neonates,which indicate the term newborns have better mature bladder function and development of nervous system.

Objective To explore the effect of chitosan on vascular smooth muscle cells inhibited proliferation from rabbit arteriovenous fistula and its mechanisms.Methods Established rabbit fistula model on carotid arteryinternal jugular vein.After 1 month cultured VSMCs with primary culture by tissue-pieces inoculation.Cultured VSMCs were divided into three groups:①normal control group.②FBS-treated group:cell were treated with 5％,10％,20％ for 48 h,respectively; established the model of rabbit VSMCs proliferation.③chitosan-treated group:VSMCs cultured with 20％ FBS were exposed to different doses of chitosan(10,100,500,1000,2000μg/ml) for 48 h.And VSMCs were treated for different time (0,12,24,48 h) with Chitosan 1000 μg/ml.Expression levels of PCNA and TLR4/ NF-κB were detected by Western blotting.RT-PCR were applied to measure the mRNA expression of PCNA and TLR4.The protein levels of TLR4 and NF-κB were detected by immunofluorescence.Results Compared with low concentration serum group,FBS-treated VSMCs exhibited a increase in mRNA and protein expression of PCNA and TLR4.FBS-induced protein expression of PCNA and TLR4/NF-κB were reduced by chitosan.Also mRNA expression of PCNA and TLR4 were reduced.They were dependent on concentration and time.In rabbit VSMCs TLR4 was mainly expressed in the cytoplasm and NF-κB expressed mainly in the nucleus.Compared with normal control group,TLR4 and NF-κB protein expression were significantly decreased by chitosan.Conclusion High concentration serum induced VSMCs proliferation.Chitosan can inhibit the proliferation of rabbit VSMCs.It is speculated that the mechanism may be related to the expression of TLR4 receptor activation,reducing expression of downstream factor MyD88 and NF-κB.It is suggest that chitosan can become potential new drugs of arteriovenous fistula prevention of intimal hyperplasia.

Objective To evaluate the effect of post-dilatation on in-stent restenosis of long lesion coronary heart disease patients received percutaneous coronary artery interventional(PCI) therapy.Methods A total of 92 cases coronary heart disease patients in Gaoxin Hospital of Xi'an from January 2008 to January 2014 were randomly divided into the post-dilatation deployment group (n =47) and control group (n =45).The postdilatation deployment group were given stent after expansion after conventional coronary stenting, while the control didn't use after expansion.The clinical features and profile of drug-eluting stent(DES) implantation and stent restenosis(examined by 256-shce spiral computed tomography coronary angiography(MSCTCA) and major adverse cardiac events(MACE) within hospitalization and 12 months were observed.Results Stent restenosis occurred in 1 patient(2.1％) in the post-dilatatioh deployment group and 8 patients(17.7％) in the control group in 12 months examed by MSCTCA,the difference was significant(P=0.03).MACE occurred in 3 patients (6.4％) in the post-dilatation deployment group and 11 patients (24.4％) in the control group, the difference was significant (P =0.03).Conclusion Routine post-dilatation tactics is effective for long lesion coronary heart disease patients with PCI.It is associated with lower coronary restenosis and lower MACE.

Objective To investigate the feasibility and safety of transcatheter closure of coronary artery fistula (CAF)with Amplatzer vascular PlugⅡ(AVPⅡ)in pediatric patients.Methods Between June 2012 and October 2015,5 children aged 0.9 to 7.0 years old and weighted 10 to 21 kg with CAF were admitted to the Department of Pediatric Cardiology in Shandong Provincial Hospital Affiliated to Shandong University.Aortic root angiography was used first to confirm the origin,shape,branches,drainage and the diameter of the orifice of CAF by deploying the pigtail catheter.The AVPⅡwas retrogradely deployed into targeted artery through guiding catheter and aortic angiography was performed before releasing the plug.Results All the 5 children underwent transcatheter closure by AVPⅡsuccessful-ly.Two cases were involved with right coronary -right ventricular fistula,1 case of left anterior descending coronary -right ventricular fistula (residual fistula after surgical repair),and 1 case of left circumflex coronary -left atrial fistula. Four children had a single fistula,and 1 case had double fistulas.The diameter of the orifice ranged from 2.00 to 5.96 mm,and the selected occluders from 8 to 14 mm.The ratio of diameter of occluder to fistula orifice ranged from 2.3 to 3.4.All the patients were followed up for 4 to 44 months.Two patients developed instant minor and modera-te aortic re-gurgitation.No other complications such as thrombosis,embolization,residual shunt,arrhythmia,coronary dissection or perforation occurred.Conclusions Transcatheter closure of CAF by AVPⅡin pediatric patients is feasible and safe. Aortic regurgitation should be noted,especially during the procedure.