1.Measurement of quantitative parameters for intravoxel incoherent motion MR imaging of uterine fibroids
Rong RONG ; Jia LIU ; Jing LIU ; Juan WEI ; Xiaoying WANG
Journal of Practical Radiology 2017;33(4):603-607
Objective To evaluate different measurement methods in histogram for the diffusion and perfusion parameters from intravoxel incoherent motion (IVIM) MR imaging of different types of uterine fibroids.Methods 63 patients with confirmed uterine fibroids (80 in total) were examined with MR imaging.3D T2WI and IVIM imaging were performed for those patients.The fibroids were classified into three types (type 1, 2, 3) on the basis of different signal intensities on T2WI according to Funaki's theory.Real diffusion coefficient (D), pseudodiffusion coefficient (D*) and perfusion fraction (f) were calculated using IVIM analysis.25%,50% and 75% of those parameters (D25,D50,D75,D*25,D*50,D*75,f25,f50 and f75) as well as mean values (Dmean,D*mean and fmean) were calculated using histogram method.ANOVA was used to compare the IVIM parameters among the three types of fibroids.Results There were 44 type 1,24 type 2 and 12 type 3 fibroids in the total of 80 fibroids.There was significant difference among all the diffusion parameters from histogram and mean values of different types of fibroids, and only one perfusion parameter D*75 value showed significant difference (P<0.05).There was no significant difference among all the f values from histogram and mean values.Conclusion Different measurements of parameters from IVIM histogram showed no added value for diffusion features in different types of fibroids compared to mean value.While the perfusion parameter D*75 value from histogram can distinguish the features of perfusion within different types of fibroids compared to mean value.
2.Myofascial pain syndrome treated with sparrow-pecking moxibustion at trigger points: a randomized controlled trial.
Yao MA ; He BU ; Ji-rong JIA ; Zheng LIU
Chinese Acupuncture & Moxibustion 2014;34(11):1073-1075
OBJECTIVETo compare the efficacy difference in treatment of myofasical pain syndrome between sparrow-pecking moxibustion and acupuncture at trigger points so as to provide the reference of the effective therapeutic method for myofascial pain syndrome.
METHODSNinety patients were randomized into a sparrow-pecking moxibustion group and an acupuncture group, 45 cases in each one. The trigger points were selected in pain areas in the two groups. In the sparrow-pecking moxibustion group, the sparrow-pecking moxibustion was applied, 30 min in each time. In the acupuncture group, the filiform needles were inserted obliquely at 45 degrees and retained for 40 min in each treatment. The treatment was given once a day and 10 treatments made one session in the two groups. The short-form McGill pain questionnaire was used as the observation index, and the changes in pain rating index (PRI), present pain intensity (PPI) and visual analogue scale (VAS) before and after treatment were used for efficacy assessment.
RESULTSThe results of PRI, PPI and VAS after treatment were reduced apparently as compared with those before treatment in the sparrow-pecking moxibustion group and the acupuncture group (all P<0.001). The differences in PRI, PPI and VAS after treatment were not significant in comparison of the two groups (both P>0.05). The curative and remarkably effective rate was 80.0% (36/45) in the sparrow-pecking moxibustion group, which was better than 40.0% (18/45, P<0.001) in the acupuncture group.
CONCLUSIONSparrow-pecking moxibustion at trigger points achieves the superior efficacy on myofascial pain syndrome as compared with acupuncture at trigger points. This therapy is simpler in operation additionally.
Acupuncture Points ; Adolescent ; Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Moxibustion ; Myofascial Pain Syndromes ; physiopathology ; therapy ; Treatment Outcome ; Trigger Points ; physiopathology ; Young Adult
3.PTEN gene expression in mouse endometria increases during embryo implantation
Xiaoling CHEN ; Rong YANG ; Yongcun JIA ; Xiaoyun LIU ; Shali WEI
Journal of Third Military Medical University 2003;0(21):-
Objective To investigate the effect of PTEN gene in the mouse uterus during embryo implantation.Methods Real-time fluorescence quantitative PCR(FQ-PCR) was used to detect PTEN mRNA expressed in the endometria of the nonpregnant mice and the late pregnant mice(day 1,day 3,day 4,day 5 and day 7),with 20 mice sacrificed at each fixed day.Out of another 20 3-day pregnant mice,ten received PTEN antisense oligonucleotide at the horn of uterus and ten received normal saline to count the blastocysts at pregnant day 8.Results The PTEN mRNA/?-actin mRNA in pregnant mice was higher than that of nonpregnant mice,gradually hoisted as days passed by,and reached the highest at pregnant day 5.The number of blastocysts in the mice that received PTEN antisense oligonucleotide was fewer than that received normal saline.Conclusion PTEN persistently expresses in mouse endometria during the early pregnancy and maybe participate in the regulation process of mouse blastodyst implantation.
4.Association between bone mineral density and left ventricular mass index in elderly men
Yanan WEI ; Lingxia CHEN ; Yide MIAO ; Jie LIU ; Rong JIA
Chinese Journal of Geriatrics 2013;(3):253-255
Objective To investigate the association between bone mineral density (BMD) and left ventricular mass index (LVMI) in elderly men in Beijing.Methods Totally 370 elderly men with an average age of (76.6±9.3) years from the departments of gerontology were included.BMD,echocardiography measurements as well as blood chemistry were analyzed.LVMI was obtained by echocardiography.All the subjects were divided into two groups:non-LVH group (n=231) and LVH group (n =139).Differences in quantitative variables were tested by independent-sample t test.Multiple stepwise linear regression analysis were performed to identify determinants of LVMI.Results The serum creatinine concentration was significantly higher in LVH group than in non-LVH group [(97.1±43.0) μmol/L,(88.2±21.1) μmol/L (P<0.05)].Compared with non-LVH group,LVH group showed that the lumbar spine BMD (L1-L4) were significantly lower[L1:(0.90±0.16) g/cm2 vs.(0.95±0.21) g/cm2,P=0.05; L2:(0.95±0.17) g/cm2 vs.(1.01±0.20) g/cm2,P<0.01 ; L3:(0.99±0.19) g/cm2 vs.(1.06±0.28) g/cm2,P<0.01] as well as the lumbar spine totalBMD [(0.97±0.18) g/cm2 vs.(1.03-1-0.26) g/cm2,P<0.05].The femur BMD was lower in theLVH group than in non-LVH group [trochiter:(0.64±0.11) g/cm2 vs.(0.67±0.17) g/cm2,P<0.05; inter area:(1.00±0.17) g/cm2 vs.(1.05±0.22) g/cm2,P<0.05].Multiple stepwise linear regression analysis demonstrated that BMI (r=0.27,P<0.01),the lumbar spine BMD (r=-0.20,P<0.01),age (r=0.16,P<0.05),serum creatinine (r=0.15,P<0.05) were independently correlated with LVMI.Conclusions In elderly men in Beijing,the lumbar spine BMD is an independent correlative factor for LVMI.
5.Cost-effectiveness Analysis of Temozolomide Combined with Radiotherapy in the Treatment of Glioblasto-ma
Peipei RONG ; Jia LIU ; Jinchun SONG ; Yue WU ; Jing FENG
China Pharmacist 2015;(8):1338-1340
To study the cost-effectiveness of temozolomide combined with radiotherapy in the treatment of glioblasto-ma. Methods:According to the clinical trial data, cost-effectiveness and sensitivity of the results was analyzed based on the domestic cost and consumption level. Results:Temozolomide combined with radiotherapy could prolong one month of overall survival with the additional cost of RMB 58 959. 7 yuan in each case when compared with radiotherapy alone. Conclusion:Temozolomide combined with radiotherapy has no advantage on cost-effectiveness when compared with radiotherapy alone.
6.Influence of hypoxia preconditioning on hypoxia-inducible factor- 1alpha in hypoxic-ischemic brain damage in the neonatal rat.
Xiang-rong ZHENG ; Yu-jia YANG ; Yan-jie JIA ; Jie-po LIU
Chinese Journal of Pediatrics 2003;41(12):946-947
Animals
;
Animals, Newborn
;
Brain
;
metabolism
;
pathology
;
Caspase 3
;
Caspases
;
metabolism
;
DNA-Binding Proteins
;
genetics
;
Gene Expression
;
Hypoxia, Brain
;
genetics
;
physiopathology
;
Hypoxia-Inducible Factor 1
;
Hypoxia-Inducible Factor 1, alpha Subunit
;
Immunohistochemistry
;
Ischemic Preconditioning
;
Nuclear Proteins
;
genetics
;
RNA
;
genetics
;
metabolism
;
Random Allocation
;
Rats
;
Rats, Sprague-Dawley
;
Reverse Transcriptase Polymerase Chain Reaction
;
Transcription Factors
7.Increased inflammatory reaction in tail-suspension mice infected by K.pneumoniae from spaceflight
Rong LIU ; Jiang CHENG ; Xuefeng PEI ; Mingwen JIA ; Jingyu WANG ; Junfeng WANG ; Changting LIU ; Ming YUAN
Military Medical Sciences 2017;41(5):377-380,389
Objective To explore the changes in inflammatory reactions in tail-suspension mice infected by Klebsiella pneumoniae from spaceflight.Methods Tail suspension was used to simulate the physiological effects of microgravity.C57BL/6 mice were randomly divided into control (Con),control+K.pneumoniae T16-169 (Con+T16-169),tail suspension (TS) and tail suspension+K.pneumoniae T16-169 (TS+T16-169) groups.The level of inflammatory cytokines TNF-α,IL-6 and IL-1β mRNA in lung tissue and the plasma cytokine concentration were detected by RT-qPCR and xMAP technology,and HE staining was used to represent the morphological changes in lung tissue.Results Compared with the control group,the expression of inflammatory cytokines in lung tissue and plasma concentrations of all experimental groups were increased,and the difference in TS+T16-169 group was the most significant (P<0.01 or P<0.001).HE staining showed that the lung tissues in Con+T16-169 and TS+T16-169 groups were damaged in different degrees,and the damage of TS+T16-169 group was the most serious.Conclusion The K.pneumoniae from spaceflight significantly increases the expression of inflammatory cytokines in lung tissue and plasma concentrations after infecting tail-suspension mice,and induces more serious damages to the lung tissue,which suggests that inflammatory reactions can be increased in tail suspension mice infected by K.pneumoniae from spaceflight.
8.Vascular-specific promoters and cis-regulatory elements.
Chinese Journal of Biotechnology 2003;19(2):131-135
Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant
;
genetics
;
physiology
;
Phenylalanine Ammonia-Lyase
;
genetics
;
Plant Proteins
;
genetics
;
Promoter Regions, Genetic
;
genetics
;
Regulatory Sequences, Nucleic Acid
;
genetics
9.LASER MUTAGENESIS AND SELECTION OF STREPTOCOCCUS ZOOEPIDEMICUS PROTOPLASTS
Li-Rong TENG ; Yan-Hou LIU ; Jia ZHANG ; Bing LIANG ; Feng WANG ;
Microbiology 1992;0(01):-
Conditions about protoplast preparation and regeneration of Streptococcus zooepidemicus,which could produce hyaluronic acid, were studied , including the concentration of lysozyme, lytic time, different osmotic stabilizers and the preculture under the high osmotic pressure . As a result, the formation and regeneration rate of protoplasts could reach up to 94.6% and 18.5% respectively under the optimum conditions, before the digestion of lysozyme (50U/mL,39℃, 60 min) the strain was cultured for 2 hours in 0.6 mol/L NaCl high osmotic pressure liquid medium containing 1.2% Gly. Among different treatments of various laser power and irradiating time, He-Ne laser which acted for 300 seconds with 40mW /cm 2 caused lethality rate as high as 99.88%. Finally, a mutated strain was gained, whose production of HA is 2.21g/L, just 4.5 times as much as the original strain.
10.Effect of compatibility with warming-inside drugs on paeoniflorin in mouse plasma
Zuyi YANG ; Jin PEI ; Rongmin LIU ; Jia CHENG ; Deguang WAN ; Rong HU
Chinese Traditional and Herbal Drugs 1994;0(02):-
Objective To establish a RP-HPLC method for the determination of the blood concentration of paeoniflorin which was produced by seven kinds of warming-inside drugs (WID) being used with the promoting-blood drugs (PBD) individually and to explore the mechanism of PBD and WID compound prescription. Methods The blood concentration of peaoniflorin in mouse plasma was determined by HPLC after ig seven kinds of WID being compatible with Radix Paeoniae Rubra (RPR) to mice separately. Results Fructus Piperis (FP), Cortex Cinnamoni (CC), Fructus Evodiae (FE), Fructus Foeniculi (FF), and Pericarpium Zanthoxyli (PZ) compound prescription with RPR can increase the blood concentration of paeoniflorin in different degrees (P