1.The Effect of Hemodialysis on Activity of Erythrocyte Immune Function and T Lymphocyte Subsets in Patients with Uremia
Dan SHI ; Ruhan JIA ; Hui FANG
Journal of Chinese Physician 2001;0(02):-
Objective To investigate the change of erythrocyte immune function and T lymphocyte subsets in patients with uremia and the effect of hemodialysis on them. Methods Flow cytometry and immune adherence rosette method were used to measure the activity of RBC-CR1and the changes of T lymphocyte subsets in 23 uremic patients without hemodialysis, 22 uremic patients before and after sigle hemodialysis and 21 healthy subjects as the control group. Results The activity of RBC-CR1, the number of T lymphocyte subsets significantly changed in patients with uremia, and hemodialysis could partially improve this condition. There was obvious correlation between erythrocyte immune function and T lymphocyte subsets. Serum creatinine was positively relative to the value of RBC-C 3b RR(P
2.Clinical observation of ruangan suopi tablet in treating chronic hepatitis B caused liver cirrhosis.
Jia-fu LI ; Hui-qin ZHANG ; Peng-hui SHI
Chinese Journal of Integrated Traditional and Western Medicine 2002;22(3):188-189
Adult
;
Drugs, Chinese Herbal
;
therapeutic use
;
Female
;
Hepatitis B, Chronic
;
complications
;
drug therapy
;
Humans
;
Liver Cirrhosis
;
drug therapy
;
etiology
;
Male
;
Middle Aged
;
Phytotherapy
;
Tablets
3.Simultaneous Determination of Total Content of p-Hydroxybenzoic Acid plus o-Hydroxybenzoic Acid and p-Hydroxybenzeneacetic Acid in Senecio Scandens Buc
Zuojun WANG ; Ping WEI ; Hui JIA ; Guobing SHI
China Pharmacist 2014;(5):767-769
Objective: To set up an HPLC method for the simultaneous determination of p-hydroxybenzoic acid plus o-hydroxy-benzoic acid and p-hydroxybenzeneacetic acid in Senecio scandens Buch. Methods:The column was a Shiseido( Fine Chemicals) Cap-cell Pak C18 (250 mm × 4. 6 mm, 5 μm) column at the room temperature. The mobile phase was methanol-water-formic acid (13∶87∶0. 5) at a flow rate of 1. 0 ml·min-1 . The detection wavelength was 240nm. Results: p-Hydroxybenzoic acid plus o-hydroxybenzoic acid had a favorable linear relationship within the range of 0. 025-0. 400 mg·ml-1 , the regression equation was Y=5. 94 × 106 X+2.46×104(r=0.9998),theaveragerecoverywas97.59% andRSDwas1.22%. p-Hydroxybenzeneaceticacidhadafavorableline-ar relationship within the range 0.05-0.80 mg·ml-1, the regression equation was Y=4.09 ×106X+1.12 ×104(r=0.999 8), the average recovery was 98. 07% and RSD was 1. 90%. Conclusion:The method is simple, feasible and reproducible. It can be used in the quality control of p-hydroxybenzoic acid plus o-hydroxybenzoic acid and p-hydroxybenzeneacetic acid in Senecio scandens Buch.
4.Recent advance in antiviral drugs for hepatitis C
Jia LIU ; Shuang SHI ; Hui ZHUANG ; Guangxiang LUO
Journal of Central South University(Medical Sciences) 2011;36(11):1025-1036
Hepatitis C virus (HCV) infection is the leading cause of chronic liver diseases worldwide.There is no vaccine to prevent HCV infection.Current standard of care (SOC) for hepatitis C is pegylated interferon-α (pegIFN-α) in combination with ribavirin (RBV).However,the efficacy of pegIFN-α and RBV combination therapy is less than 50% for genotype 1 HCV,which is the dominant virus in human.Additionally,IFN and RBV are highly toxic,causing severe side effects.Therefore,it is urgent to develop safer and more efficacious anti-HCV drugs.Over the last decade,a number of HCV-specific inhibitors have been discovered with many of them reached to late stages of clinical trials.Recently,2 HCV NS3 protease inhibitors,telaprevir and boceprevir,have been approved by the Unite States Food and Drug Administration (FDA).This opens up a new era for anti-HCV therapy.Several new classes of antiviral drugs targeting HCV NS3 protease,NS5A and NSSB RNA-dependence RNA polymerase (RdRp) are currently at various stages of preclinical and clinical studies.Upon approval of more NS3 protease,NS5A and NS5B polymerase inhibitors,future clinical studies will lead to optimal combination therapies which will have desirable parameters such as IFN-free,higher efficacy,safe,one daily dose and short duration.
5.The immunomodulatory effect of lactic acid within the tumor microenvironment
Wei-xiang GE ; Shi-jia YAN ; Guo-hui WAN
Acta Pharmaceutica Sinica 2022;57(9):2570-2579
Tumor cells leads to enhanced glucose uptake and the conversion of a larger fraction of pyruvate into lactate even under the circumstance of abundant oxygen. This phenomenon of aerobic glycolysis is known as the Warburg effect. Lactic acid, as an important tool for tumor cells to modify the tumor microenvironment, promotes the process of tumor invasion and metastasis, and contributes to tumor development by inducing and recruiting immunosuppression-related cells and molecules. Lactic acid could efflux out of the cancer cells
6.Tryptophan and tumor immunity
Chi ZHANG ; Shi-jia YAN ; Guo-hui WAN
Acta Pharmaceutica Sinica 2022;57(9):2580-2589
As an essential amino acid, tryptophan (Trp) has various physiological functions and is of great significance in the metabolic process of tumors. In the human body, tryptophan is mainly transformed through kynurenine metabolic pathway, which not only promotes the inherent malignant properties of tumor cells, but also leads to immune-suppressive tumor microenvironment. Changes in tryptophan metabolism often occur in tumors, accompanied by abnormal gene expression of tryptophan-related enzymes, among which indoleamine 2,3-bioxygenase (IDO)-related gene expression and tryptophan 2,3-dioxygenase (TDO)-related gene changes are the most significant. A large number of clinical trials on IDO inhibitors, TDO inhibitors and combination therapy have been carried out. This paper reviewed the tryptophan metabolic pathway, regulation of IDO (TDO), kynurenine (KYN) and other related genes in tumor cells, and outlined the development of therapeutic schedule targeting tryptophan-related genes. The new progress provides new ideas for the further exploration of tumor treatment options.
8.Molecular Identification of Serpentis Periostracum and Its Adulterants Based on COI Sequence
Linchun SHI ; Jun CHEN ; Dong LIU ; Hongyin ZHANG ; Jing JIA ; Hui ZHANG ; Hui YAO
World Science and Technology-Modernization of Traditional Chinese Medicine 2014;(2):284-287
Objective: This study aimed to distinguish Serpentis Periostracum from its adulterants, which will provide the basis for its safe application. Methods: Here, COI sequences of 68 samples from 13 species were PCR amplified and sequenced. Furthermore, the DNA Barcoding Gap and phylogenetic cluster analysis were carried out. Results:The results exhibited that the COI sequences of all the three origin animals of Serpentis Periostracum have DNA Barcoding Gap. For phylogenetic cluster analysis, all the three origin animals showed monophyletic and every species can be discriminated clearly. Conclusion: COI is an effective DNA barcode for the identification of Serpen-tis Periostracum.
9.Research on spectral reflectance characteristics for Glycyrrhizae Radix.
Hui LI ; Cai-Xiang XIE ; Xiao-Jin LI ; Mei-Jia WEN ; Guang-Lin JIA ; Ming-Hui SHI ; Bao-Lin GUO ; Xiao-Guang JIA
China Journal of Chinese Materia Medica 2014;39(3):427-432
In order to study the spectral reflectance differences of Glycyrrhizae Radix under different growth conditions and lay the foundation for quantitative monitoring of Glycyrrhizae Radix remote sensing images, spectra of Glycyrrhiza species under different growth period and different varieties and different regions were measured by a portable spectrometer. The results showed that the reflectivity of annual G. uralensis was obviously higher than that of the two years plant in the visible light band own to the contents of crown layer chlorophyll. The reflectivity of two years G. pallidiflora was higher than that of G. uralensis in the near infrared band own to the leaf area index and the content of leaf water. The red edge spectrum of annual plant fluctuated largely than that of two years plant due to vegetation coverage and leaf area index. G. pallidiflora grew well than G. uralensis. Under different regions of the Glycyrrhiza species, spectral data analysis showed that within a certain range, the average annual precipitation and average annual evaporation were the major factors to affect the differences of Glycyrrhiza species spectral data under different regions owe to the leaf water content, the higher leaf water content, the lower spectral reflectance. The principal component analysis and continuum-removed method of the spectral data under different regions found that, within a certain range, the average annual precipitation and average annual evaporation were the major factors caused by the differences of Glycyrrhiza species spectral data under the different regions, Glycyrrhiza species spectral similarity related to the spatial distance.
Geography
;
Glycyrrhiza
;
chemistry
;
Principal Component Analysis
;
Spectrum Analysis
10.Vascular-specific promoters and cis-regulatory elements.
Chinese Journal of Biotechnology 2003;19(2):131-135
Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant
;
genetics
;
physiology
;
Phenylalanine Ammonia-Lyase
;
genetics
;
Plant Proteins
;
genetics
;
Promoter Regions, Genetic
;
genetics
;
Regulatory Sequences, Nucleic Acid
;
genetics