To establish induction and liquid culture system for hairy roots of Danshen (Salvia miltiorrhiza), Agrobacterium rhizogenes A4, LBA9402, 15834 as test bacterium were used to infect aseptic leaves of Danshen. The hairy roots were induced and positive transgenic hairy roots were selected with PCR using rolB and rolC as the target gene. Then hairy roots of S. miltiorrhiza were harvested and salvianolic acids were extracted with 70% methanol containing 1% formic acid. The content of salvianolic acid B (SalB) and rosmarinic acid (RA) were determined by HPLC. According to the above research results, the Danshen hairy roots induced by A. rhizogenes LBA9402 were inoculated into the following group of culture media: MSOH, MS, B5, and 6,7-V liquid media. Then the same methods of extraction and determination for the content of Danshen hairy roots were adopted. Last, the hairy roots of S. miltiorrhiza induced by A. rhizogenes LBA9402 were inoculated into the MSOH liquid media with different pH values. The content of salvianolic acid were extracted with 70% methanol containing 1% formic acid and determined by HPLC. As a result, three kinds of A. rhizogenes A4, LBA9402, 15834 could induce hairy roots and Ri plasmids were integrated into the genome of S. miltiorrhiza by PCR. Danshen hairy roots induced by A. rhizogenes LBA9402 and A4 produced much more salvianolic acid, which were (3.27 ± 0.37)% [including (1.04 ±0.36)% of RA and (2.22 ± 0.29)% of SalB] and (3.17 ± 0.20)% [including (0.92 ± 0.31)% of RA and (2.25 ± 0.26)% of SalB], respectively. Hairy roots induced by A. rhizogenes LBA9402 when they were cultured in MSOH liquid media produced much more salvianolic acid, which was (4.56 ± 0.36)%, including (1.12 ± 0.26)% of RA and (3.44 ± 0.23)% of SalB. Hairy roots induced by A. rhizogenes LBA9402 produced the most salvianolic acid when they were cultured in MSOH liquid media with the pH value 4.81, which was 4.85%, including 1.16% of RA and 3.69% of SalB. So Danshen hairy roots induced by A. rhizogenes LBA9402 and A4 produced much more salvianolic acid when they were cultured in MSOH liquid media with the pH value 4.81. The research had established the foundation on genetic engineering to improve the quality of S. miltiorrhiza.
Agrobacterium ; physiology ; Benzofurans ; analysis ; metabolism ; Cell Culture Techniques ; instrumentation ; methods ; Cinnamates ; analysis ; metabolism ; Culture Media ; chemistry ; metabolism ; Depsides ; analysis ; metabolism ; Drugs, Chinese Herbal ; analysis ; metabolism ; Plant Roots ; chemistry ; growth & development ; metabolism ; microbiology ; Salvia miltiorrhiza ; chemistry ; growth & development ; metabolism ; microbiology

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant ; genetics ; physiology ; Phenylalanine Ammonia-Lyase ; genetics ; Plant Proteins ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics

Prolyl-4-hydroxylase domain (PHDs) family is one of the most important regulatory factors in hypoxic stress. PHD2 plays a critical role in cells and tissues adaptation to the low oxygen environment. Its hydroxylation activity regulates the stability and transcriptional activity of the hypoxia-inducible factor 1 (HIF-1), which is the key factor in response to hypoxic stress. Subsequently, PHD2 acts as an important factor in oxygen homeostasis. Studies have shown that PHD2, through its regulation on HIF-1, plays an important role in the post-ischemic neovascularization. Furthermore, under hypoxic condition, PHD2 also regulates other pathways that positively regulate angiogenesis factors HIF-1 independently. Moreover, recently, several evidences have also shown that PHD2 also affects tumor growth and metastasis in a tumor microenvironment. Based on these facts, PHD2 have been considered as a potential therapeutic target both in treating ischemic diseases and tumors. Here, we review the molecular regulation mechanism of PHD2 and its physiological and pathological functions. We focus on the role of PHD2 in both therapeutic angiogenesis for ischemic disease and tumor angiogenesis, and the current progress in utilizing PHD2 as a therapeutic target.
Animals ; Humans ; Hydroxylation ; Hypoxia-Inducible Factor 1 ; metabolism ; Hypoxia-Inducible Factor-Proline Dioxygenases ; antagonists & inhibitors ; physiology ; Neoplasms ; blood supply ; metabolism ; pathology ; therapy ; Neovascularization, Pathologic ; metabolism ; pathology ; Tumor Microenvironment ; Vascular Diseases ; pathology ; therapy

BACKGROUND: As a primary clinical predictor of fracture risk, bone mineral density (BMD) is partly genetically determined. Osteoprotegerin (OPG) is one important candidate gene in the pathogenesis of osteoporosis. OBJECTIVE: To investigate the association between T245G polymorphisms in the OPG gene and BMD. METHODS: A total of 281 elderly men and postmenopausal women, 182 males and 99 females, who received routine examinations at Peking University People's Hospital between September 2008 and April 2010 were included in this study. T245G polymorphisms in the OPG gene was detected by polymerase chain reaction-restriction fragment length polymorphism together with DNA sequencing. The BMD of the lumbar spine, Ward's triangle, and forearrm was determined by dual energy X-ray absorptiometry. Clinical variables and biochemical measurements were collected simultaneously. The association between T245G polymorphisms and each detection index was analyzed using analysis of variance. RESULTS AND CONCLUSION: The distribution of T245G genotype (alleles T, G) had no difference in elderly men or postmenopausal women (P > 0.05). The GG genotype and TG genotype had higher lumbar spine BMD and TT genotype had lower lumbar spine BMD (P < 0.05). There was no difference in BMD of the Ward's triangle or forearm among different genotypes (P > 0.05). Association between T245G polymorphism and BMD was not found in postmenopausal women. These findings indicate that OPG gene is related to lumbar spine BMD in elderly men.

Objective To investigate the incidence of auditory nerve pathway injury complicated with cere- bral palsy(CP) and its related factors relationship between the incidence rate of it and sexes,classification and risk factors. Methods The clinical data of 272 children with CP,including the data of brainstem auditory evoked po- tentials,were retrospectively reviewed.The incidence of auditory nerve pathway injury and the related factors were analyzed.Results In the 272 CP children,the incidence of auditory nerve pathway injury was 29.8% (81:272), which had a significantly relationship with the clinical types of CP (P0.05).In addition,it was found that the pathological jaundice (OR=2.945,95% CI:1.649-5.260) and intrauterine infection (OR=3.319,95% CI:1.037-10.625) were significantly related to auditory nerve pathway injury. Conclusion The auditory nerve pathway injury is common in CP children,especially in those with athetosis and mixed CP.Pathological jaundice and intrauterine infection are the risk factors of auditory nerve pathway injury.

To retrospectively analyze the clinical data of a child with congenital broncho-bile duct fistula(CBBF) in Guiyang Children′s Hospital in June 2019.A female, aged 7 years and 6 months old, patient presented cough with a large amount of yellow green mucus.The main clinical manifestation was recurrent pulmonary infection after birth.After the fistula was found by electronic bronchoscope, doctors cooperated with imaging department, anesthe-siology department and pediatric surgery department.After treatment, the child recovered and discharged.There are few reports on CBBF.This study suggested that, in view of the refractory pneumonia with recurrent pulmonary infection and yellow green sputum after birth, and that the effect of anti-infection treatment was poor, clinicians should pay attention to the CBBF, take bronchoscopy as soon as possible, and make early diagnosis by combining with imaging technology, thus formulating a reasonable diagnosis and treatment plan under multidisciplinary cooperation, so as to improve the diagnosis and treatment of this rare disease clinical diagnosis and treatment level, and reduce missed diagnosis and misdiagnosis as well.

Abstract?AlM: To evaluate the visual impairment in cerebral palsy children with series objective indicators, and conclude their clinical features of visual function.? METHODS: Objective tests including following pursuing test, optokinetic nystagmus(OKN) drum test, refractive error examination, fundus examination, ocular deviation examination, pattern visual evoked potential ( P-VEP ) tests and brain magnetic resonance imaging ( MRl) were carried out in 43 cerebral palsy children ( 86 eyes ) with ocular visual dysfunction; The visual impairment data of the cerebral palsy children were collected, and the clinical features and possible mechanism were analyzed.?RESULTS: 1. Of the 43 cerebral palsy children ( 86 eyes) with the visual impairment presented diversified, 25 ( 50 eyes, 58. 1%) of refractive error, 24 ( 48 eyes, 55. 8%) of strabismus, 12 ( 24 eyes, 27. 9%) with nystagmus, 19 ( 38 eyes, 44. 2 %) of optical nerve atrophy or hyperplasia, 35 ( 70 eyes, 81. 4%) of VEP abnormality. Among children with spastic cerebral palsy, the incidence of visual impairment was statistically significant difference compared with other groups (P<0. 01). 2. There were 16 cases (32 eyes,37. 2%) with esotropia, 6 cases ( 12 eyes, 14. 0%) with exotropia and 2 cases ( 4 eyes, 4. 7%) with vertical deviation. Strabismus was most common in spastic cerebral palsy children, totally 13 (26 eyes, 30. 2%) with esotropia, and exotropia was common in hypotonia and other types cerebral palsy children; 3. 23 ( 46 eyes, 53. 5%) with hyperopia, 8 ( 16 eyes, 18. 6%) with myopia, 16 ( 32 eyes, 37. 2%) with astigmutism and 14 cases (28 eyes, 32. 6%) with anisometropia;4. Cerebral palsy children were usually with decreased VEP amplitude and prolong latency, and poor wave formation, mostly in spastic cerebral palsy children; 5. Visual abnormality was most common in occipital cortex damage and periventricular leukomalacia ( PVL ) . The incidence in PVL and occipital cortex had no statistically significant difference ( P > 0. 05 ), no nystagmus in patients with severe occipital cortex damage.?CONCLUSlON: Cerebral palsy children were usually with visual impairment, and presented with special clinical features; Comprehensive objective visual tests are accurate and reliable for evaluation of the visual function in cerebral palsy children.

Objective: To observe the clinical efficacy of tuina manipulations in treating different types of tic disorders (TD). Methods: Eligible TD patients were classified into three types, transient tic disorders (TTD), chronic multiple tic disorders (CMTD) and Tourette syndrome (TS), according to their disease duration and severity. The three types of children were treated with the same tuina manipulations. Changes in the Yale global tic severity scale (YGTSS) score, effective rate for tic, and cervical spine imaging examination results (including asymmetry of the lateral atlanto-dental interval, broadened anterior atlanto-dental interval, C2 spinous process deviation, occipito-atlanto-axial flexion/ extension instability) were observed after 1-month and 3-month treatments respectively. Results: The YGTSS score changed significantly after 1-month and 3-month treatments compared with that before treatment (both P<0.01); the effective rate for TD was 46.6％ and 86.7％ respectively after 1-month and 3-month treatments; there were significant differences comparing the effective rate for tic between different types of TD after 1-month and 3-month treatments (all P<0.05); comparing the effective rate for tic after 1-month treatment with that after 3-month treatment for the same type, the intra-group differences were statistically significant [TTD group (P<0.01), CMTD group (P<0.01), TS group (P<0.05)]; the abnormal parameter rates in neck imaging examination after 3-month treatment were significantly different from those before treatment (all P<0.01). Conclusion: Tuina manipulation is effective for TTD, CMTD and TS. It can correct the abnormal alterations of patients' cervical vertebrae, and its efficacy for TTD is most significant.

italic>Salvia miltiorrhiza Bunge is a traditional Chinese medicinal herb widely used to treat cardiovascular and cerebrovascular diseases at clinic. Its main water-soluble components are rosmarinic acid (RA) and salvianolic acid B (SAB), which are produced by phenylpropanoid pathway. 4-Hydroxyphenylpyruvate reductase (HPPR) is a key enzyme in phenylpropanoid metabolism pathway. SmHPPR1 was cloned from S. miltiorrhiza and was constructed into plant expression vector pJR-SmHPPR1. On this basis, SmHPPR1 transgenic Arabidopsis plants were induced and the content of 4-hydroxyphenyllactic acid (pHPL) was determined. SmHPPR1-overexpressing (SmHPPR1-OE) hairy roots of S. miltiorrhiza were obtained and the concentration of active components and transcriptome analysis were performed. The results showed that the concentration of pHPL in SmHPPR1 transgenic Arabidopsis T1 was 0.594 mg·g^-1 dry weight. The concentration of RA, SAB and total salvianolic acid in SmHPPR1-OE-3 hairy roots were 1.09, 1.29, 1.15 times of that in control-3, respectively, and the content of Danshensu was 36.26% of that in control-3. Transcriptomic analysis revealed that overexpression of SmHPPR1 caused the upregulation of other phenylpropanoid pathway genes like SmTAT2. Protein-protein interaction indicated CYT (TR74706_c0_g1), NADP⁺ (TR26565_c0_g1) and NADP⁺ (TR68771_c0_g1) is the central node of the network and participated in metabolic process and cellular process. The tracking work in this study proved that SmHPPR1 could catalyze the reduction of 4-hydroxyphenylpyruvic acid to 4-hydroxyphenyllactic acid in SmHPPR1 transgenic Arabidopsis, and SmHPPR1-overexpressing in hairy roots of S. miltiorrhiza could increase the concentration of salvianolic acids through synergistically regulating other pathway genes.

OBJECTIVETo elucidate the molecular mechanism of Wendan Tang in prevention of lipid metabolism disorder in adult rats.

METHODOn the basis of hyperlipidemia rat models, triglycerides (TG), total cholesterol (TC) in serum, activities of lipase (LA), lipoprotein lipase (LPL), hepatic lipase (HL) in liver, parts of hemogram and hepatic LDLR mRNA levels were investigated 21 days after the feeding of atherogenic diet.

RESULTWendan Tang significantly reduced the serum TG, TC and increased the activity of LPL and LA, but caused no chang in HL. The result of RT-PCR test showed that high fat and high cholesterol feeding could significantly induce the reduction of LDLR mRNA levels, while Wendan Tang could increase hepatic LDLR density.

CONCLUSIONWendan Tang can prevent disorder of lipid metabolism by regulating TC, TG, LDL-c through upregaulation of LDLR transcription level and improving antioxidant ability.

Animals ; Drug Combinations ; Drugs, Chinese Herbal ; isolation & purification ; pharmacology ; Female ; Hyperlipidemias ; blood ; metabolism ; prevention & control ; Lipid Metabolism ; Liver ; metabolism ; Male ; Plants, Medicinal ; chemistry ; RNA, Messenger ; biosynthesis ; genetics ; Rats ; Receptors, LDL ; biosynthesis ; genetics