Objective To investigate the effeit of Reconstruction of tantalum metal rod implantation in the treatment of early ischemic necrosis of femoral head( Steinberg Ⅰ～Ⅱ period) ,to explore the early femoral head ischemic necrosis of minimally invasive treatme(n)t. Method 24 patients( Steinberg Ⅰ～Ⅱ period) using C-arm fluoroscopy machine,under the greater trochanter through the neck hole to avascular necrosis zone,the first zone of the medullary sclerosis core decompression, re-implantation of tantalum rod to the subchondral bone is about 0.5 cm, through the Harris score before and after surgery for comparison. Results After follow-up 9(2 ～ 12) months,preoperative pain and function were significantly limited nuitigation. The excellent rate was 83% after opertion. MRI manifestations in patients with stable,non-ischemic necrosis increased performance. Conclusion Core decompression can significantly reduce the pressure on the femoral head hardening region, tantalum rod weight-bearing area of femoral head implant provides a structural support for subchondral bone. This method has the characteristics decompression,structural support,minimally invasive,it is worth for clinical use.

Aim To further study the molecular mecha-nism of the herbs with hot nature on the regulational action on TRPV1 channel based on the 7900 Real-time PCR instrument. Methods 7900 PCR instrument was applied to detect the intracellular flurescence of TRPV1 channel in the dorsal root ganglions ( DRG ) neurons and the effect on the TRPV1 ’ s thermo-sensational functions of the selected 11 ingredients from hot herbs was explored. Results TRPV1 channels could be ac-tivated by gradually elevated temperature; the activa-tion process could be blocked by the TRPV1 specific blocking agent capsaizepine. Most of the ingredients from hot-nature herbs had the potential to up-regualate TRPV1 channel function. Conclusions The estab-lished TRPV1 channel detection system based on PCR instrument is suitable for the analysis of regulational functions of drugs on the heat-activated TRPV1 chan-nel;the functions of hot herbs may be related to the up-regualtional effects of its active ingredients on the TRPV1 channel which will further up-regulate energy metabolism.

Objective To explore the influence of lovers''communication patterns and matching on their depression symptoms. Methods 300 pairs of dating couple were recruited from nine universities in Hebei,Henan,Beijing and Shanghai by convenience sampling principle. They were asked to fulfill the com-munication patterns questionnaire-short form and center for epidemiologic studies depression scale.Polynomial regression model with response surface method was adopted to analyze the results. Results ( 1) The scores of demands/withdraw,completely avoid,constructive communication of boys and girls were (3.93±1.10,4.10 ±1.09)(6.65±1.70,6.49±1.74)(3.85±1.70,4.02±1.98),and the scores of depression of boys and girls were (1.60±0.42,1.61±0.42).Boys depression was significantly positive correlated with its own demands/withdraw communication( r=0.222, P<0.01),and significantly positive correlated with girls demands/with-draw communication ( r=0.118, P< 0.05).Girls depression was significantly negative correlated with con-structive communication of their own( r=-0.407, P<0.01),and significantly negative correlated with the boys constructive communication ( r=-0.306, P<0.01). (2)Demand/withdraw communication could predict their own depression positively both for males and females( t=5.489,b=0.267, P<0.01, t=2.538,b=0.138, P<0.05).Constructive communication could predict depression negatively both for males and females( t=-5.158,b=0.382, P<0.01;t=-4.539,b=0.299, P<0.001 ).Males'' avoidance communication pattern could predict their own depression positively( t=1.918,b=0.174, P<0.05).(3)Males''constructive communication scores could predict females'' depression negatively( t=-3.306,b=0.189, P<0.01 ).(4)The consistency of communication pattern could influence couples'' depression. Conclusion Constructive communication con-tributes to lovers'' mental health and reduce the probability of their depression;Demand/withdraw communi-cation and avoidance communication increase their depression risk.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

Objective To investigate the correlation of spinal canal stricture and intramedullary increased signal intensity (ISI) in patients with ossification of the posterior longitudinal ligament (OPLL). Methods 92 patients with OPLL were divided into 3 groups, those with the sagittal diameter remained ≥66.7% were as group A, 33.3%~66.7% as group B, and <33.3% as group C. The incidence of intramedullary ISI was recorded, and their neurological condition was assessed with the Japanese Orthopedics Association Assessment (JOA). Results ISI were found in 6 cases in the group A (20.7%), 17 cases in the group B (47.2%) and 19 cases in the group C (70.4%) (P<0.05). The score of JOA was (7.1±2.1) in the group A, (6.0±1.8) in the group B and (5.6±2.0) in the group C (P<0.05). Conclusion The incidence of intramedullary ISI increased with the severity of spinal canal stricture, and with more severe nerve damage in OPLL patients.

Objective To evaluate the effect of extensive resection and immediate reconstruction based on classification of abdominal wall defects for patients with abdominal wall neoplasms.Methods From Jan 1999 to May 2016,112 patients with abdominal wall neoplasms were treated with extensive resection,including Type Ⅰ (n =20),Type Ⅱ (n =45) and Type Ⅲ (n =47).Immediate abdominal wall reconstruction comprised primary sutures or free skin graft for Type I defects,component separation (CST) with or without a prosthetic or biological mesh reinforcement for Type Ⅱ defects and pedicled or vascularized myocutaneous flap with or without a prosthetic or biological mesh or prosthetic + biological mesh with or without CST for Type Ⅲ defects.Results The average follow up was 76.86 ± 21.22 months,3 patients developed flap necrosis,9 patients suffered from wound infection.Local recurrence was observed in 20 patients,35 patients developed distant metastasis.Conclusions The optimal strategy based on the abdominal wall defect classification for immediate reconstruction of huge abdominal wall defects is safe and effective after resection of abdominal wall neoplasms.

In the present study, an ultra performance liquid chromatography coupled with time-of-fight mass spectrometry (UPLC-TOF/MS) based chemical profiling approach was used to evaluate chemical constitution between co-decoction and mixed decoction of ginseng and Radix Aconiti Praeparata. Two different kinds of decoctions, namely co-decoction of ginseng and Radix Aconiti Praeparata: water extract of mixed two herbs, and mixed decoction of ginseng and Radix Aconiti Praeparata: mixed water extract of each individual herbs, were prepared. Batches of these two kinds of decoction samples were subjected to UPLC-TOF/MS analysis. The datasets of t(R) m/z pairs, ion intensities and sample codes were processed with supervised partial least squared discriminant analysis (OPLS-DA) to holistically compare the difference between these two decoction samples. Significant difference between the two decoction samples was showed in the results of positive ion mode. The contents of hypaconitine and deoxyaconitine decreased, while that of benzoylmesaconine, benzoylhypaconine and dehydrated benzoylmesaconine increased in the samples of co-decoction of ginseng and Radix Aconiti Praeparata. The content of diester-diterpenoid alkaloids decreased, while that of monoester-diterpenoid alkaloids increased, which is probably the basis of toxicity-attenuated action when combined ginseng with Radix Aconiti Praeparata.

Objective To explore the effect of the prevention and treatment of unstable bladder after suprapubic prostaectomy by capsaicin instilled into the bladder preoperatively combined with patient-controlled epidural analgesia(PCEA)for benign prostatic hyperplasia(BPH).Methods Sixty patients with BPH underwent suprapubic prostatectomy under epidural anesthesia were randomly divided into control group (30 cases)and treatment group(30 cases),100 ml of 100 μmol/L capsaicin was instilled into the bladder preoperatively for 30 minutes combined with PCEA after operation in treatment group,the control group was only given PCEA.Observed the incidence and continuous time of unstable bladder after operation in two groups.Results Unstable bladder was found in 3 cases of treatment group and they were Ⅰdegree,12 cases happened unstable bladder in control group,3 cases Ⅰdegree,5 cases Ⅱdegree,3 cases Ⅲ degree,1 case Ⅳ degree.There was obvious significance between two groups (P＜0.05).Conclusion Capsaicin instilled into the bladder combined with PCEA can cut off the reflex arc of detrusor contraction more completely and has obvious effect of decrease the incidence of unstable bladder after suprapubic prostatectomy and can be used widely.

Objective To evaluate the respiration-induced target volume motion in 3D-CRT for mid-thoracic esophageal carcinoma in order to guide the radiation oncologist to choose the expansion marginfor ITV.Methods Ten patients with mid-thoracic esophageal carcinoma were scanned by multi-spiral CTsimulator respectively in free breathing(FB),breath.hold after normal inspiration and expiration(IBH and EBH)with the same scanning range.Then the CT images of three series were transfefred to the treatmentplanning system.The target volume was outlined following the same standard.The motion of the centerpoint of GTV,the center point of each slice of GTV and the edge of the GTV in selected slice weremeasured respectively to obtain the comprehensive value of GTV motion。in order to find the appropriate IMvalue according to the 95％confidence interval of the GTV motion.Results①The GTV motion betweenIBH and EBH was(0.19±0.16)cm in the left.right direction,(0.54±0.19)cm in the cranial andcaudal irection.and(0.16±0.14)cm in anterior.posterior directions for the center of GTV,.For thecenter point of each slice of GTV.they ere(0.19±0.15)cm,(0.54±0.16)cm,(0.16±0.13)cm in three directions above.respectively.For the edge of the GTV in selected slice.they were(0.26±0.19)cm,(0.54±0.18)cm,(0.24±0.19)cm,respectively.The comprehensive value of GTV motion between IBH and EBH was(0.23±0.17)cm,(0.54±0.17)cm,(0.21±0.17)cm.respectively.The 95％confidence interval was 0.21-0.25 cm.0.53-0.56 cm and 0.19-0.22 cm in three directions.②The direction of GTV motion：No motion was noticed in 8.2％.while 73.3％to the right side and 18.5％to the left side in the left-right direction when IBH were compared with EBH.100％were moved to caudal in the the cranial and caudal direction[(0.54±0.17)cm].In the anterior-posterior direction,no motion was noticed in 8.2％,while 16.6％to the posterior and 75.2％to the anterior when IBH were compared with EBH.③The GTV motion was correlated with the vafiance of 1ung volumes in IBH-EBH(r=0.683,P=0.032)and not with GTV volume and length.Conclusions Respiration can induce target volume motion in 3 DCRT for mid-thoracic esophageal carcinoma.Compared to EBH.the GTV tends to move to the caudal,the anterior and the ight side in IBH.

BACKGROUND:Tranexamic acid is extensively used in the primary total knee replacement, but there are many different methods. OBJECTIVE:To explore the efficacy and safety of the intra-articular injection of tranexamic acid with pressurization in reducing the blood loss of primary total knee replacement. METHODS:Total y 56 patients undergoing unilateral total knee arthroplasty were enrol ed and randomly divided into two groups. Patients were given the intra-articular injection of 100 mL of saline solution dissolving 2.0 g of tranexamic acid with large pad pressure bandaging the knee, and 4-hour drainage tube close, and then underwent negative pressure suction (experimental group);differently, the controls were given the normal pad bandage group. The drainage tube was removed within 48 hours after replacement. The patient blood routine examination was performed at the 3rd day, and at the same time, the volume of drainage was recorded;and the color Doppler ultrasound in ipsilateral lower extremity veins was conducted to observe the incidence of thrombosis at 4-5 days. RESULTS AND CONCLUSION:(1) The total blood loss, postoperative dominant blood loss, and hidden blood loss in the experimental group were significantly less than those in the control group (P<0.05). (2) No significant difference was found in the incidence of postoperative thrombosis between two groups (P>0.05). (3) These results indicate that the intra-articular injection of tranexamic acid with pressurization can significantly reduce the postoperative blood loss in the primary total knee arthroplasty, without increasing the risk of deep vein thrombosis.