Objective To investigate the effeit of Reconstruction of tantalum metal rod implantation in the treatment of early ischemic necrosis of femoral head( Steinberg Ⅰ～Ⅱ period) ,to explore the early femoral head ischemic necrosis of minimally invasive treatme(n)t. Method 24 patients( Steinberg Ⅰ～Ⅱ period) using C-arm fluoroscopy machine,under the greater trochanter through the neck hole to avascular necrosis zone,the first zone of the medullary sclerosis core decompression, re-implantation of tantalum rod to the subchondral bone is about 0.5 cm, through the Harris score before and after surgery for comparison. Results After follow-up 9(2 ～ 12) months,preoperative pain and function were significantly limited nuitigation. The excellent rate was 83% after opertion. MRI manifestations in patients with stable,non-ischemic necrosis increased performance. Conclusion Core decompression can significantly reduce the pressure on the femoral head hardening region, tantalum rod weight-bearing area of femoral head implant provides a structural support for subchondral bone. This method has the characteristics decompression,structural support,minimally invasive,it is worth for clinical use.

Objective To explore the influence of lovers''communication patterns and matching on their depression symptoms. Methods 300 pairs of dating couple were recruited from nine universities in Hebei,Henan,Beijing and Shanghai by convenience sampling principle. They were asked to fulfill the com-munication patterns questionnaire-short form and center for epidemiologic studies depression scale.Polynomial regression model with response surface method was adopted to analyze the results. Results ( 1) The scores of demands/withdraw,completely avoid,constructive communication of boys and girls were (3.93±1.10,4.10 ±1.09)(6.65±1.70,6.49±1.74)(3.85±1.70,4.02±1.98),and the scores of depression of boys and girls were (1.60±0.42,1.61±0.42).Boys depression was significantly positive correlated with its own demands/withdraw communication( r=0.222, P<0.01),and significantly positive correlated with girls demands/with-draw communication ( r=0.118, P< 0.05).Girls depression was significantly negative correlated with con-structive communication of their own( r=-0.407, P<0.01),and significantly negative correlated with the boys constructive communication ( r=-0.306, P<0.01). (2)Demand/withdraw communication could predict their own depression positively both for males and females( t=5.489,b=0.267, P<0.01, t=2.538,b=0.138, P<0.05).Constructive communication could predict depression negatively both for males and females( t=-5.158,b=0.382, P<0.01;t=-4.539,b=0.299, P<0.001 ).Males'' avoidance communication pattern could predict their own depression positively( t=1.918,b=0.174, P<0.05).(3)Males''constructive communication scores could predict females'' depression negatively( t=-3.306,b=0.189, P<0.01 ).(4)The consistency of communication pattern could influence couples'' depression. Conclusion Constructive communication con-tributes to lovers'' mental health and reduce the probability of their depression;Demand/withdraw communi-cation and avoidance communication increase their depression risk.

Aim To further study the molecular mecha-nism of the herbs with hot nature on the regulational action on TRPV1 channel based on the 7900 Real-time PCR instrument. Methods 7900 PCR instrument was applied to detect the intracellular flurescence of TRPV1 channel in the dorsal root ganglions ( DRG ) neurons and the effect on the TRPV1 ’ s thermo-sensational functions of the selected 11 ingredients from hot herbs was explored. Results TRPV1 channels could be ac-tivated by gradually elevated temperature; the activa-tion process could be blocked by the TRPV1 specific blocking agent capsaizepine. Most of the ingredients from hot-nature herbs had the potential to up-regualate TRPV1 channel function. Conclusions The estab-lished TRPV1 channel detection system based on PCR instrument is suitable for the analysis of regulational functions of drugs on the heat-activated TRPV1 chan-nel;the functions of hot herbs may be related to the up-regualtional effects of its active ingredients on the TRPV1 channel which will further up-regulate energy metabolism.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

Objective To investigate the correlation of spinal canal stricture and intramedullary increased signal intensity (ISI) in patients with ossification of the posterior longitudinal ligament (OPLL). Methods 92 patients with OPLL were divided into 3 groups, those with the sagittal diameter remained ≥66.7% were as group A, 33.3%~66.7% as group B, and <33.3% as group C. The incidence of intramedullary ISI was recorded, and their neurological condition was assessed with the Japanese Orthopedics Association Assessment (JOA). Results ISI were found in 6 cases in the group A (20.7%), 17 cases in the group B (47.2%) and 19 cases in the group C (70.4%) (P<0.05). The score of JOA was (7.1±2.1) in the group A, (6.0±1.8) in the group B and (5.6±2.0) in the group C (P<0.05). Conclusion The incidence of intramedullary ISI increased with the severity of spinal canal stricture, and with more severe nerve damage in OPLL patients.

Objective To access the incidence,clinical characteristics and the factors affecting therapy of respiratory distress syndrome (RDS) in the infants at term and near term delivered by elective cesarean section.Methods A retrospective cohort study among consecutively admitted infants with RDS at the Neonatal Intensive Care Unit of the Department of Neonatology,Xiangya Hospital,Central South University from Jan.2004 to Dec.2011 were conducted.The inborn infants at 36-42 weeks gestation with RDS,whom were delivered by Elective Cesarean Section from January 1 st,2004 to December 31st,2011 were enrolled.These cases with the timing of elective caesarean section,gestational age,intrauterine infection,asphyxia at birth,which affecting the occurrence of RDS were compared.Results Fifty one infants were entered into the study,which were all met standard of Elective Cesarean Section.Among these infants,33 cases (64.7％,33/51 cases) were delivered by cesarean section without any reason.In these 51 cases,the constituent ratio of elective caesarean section in gestational age ＞ 39 weeks was lower than in gestational age ＞ 36-＜39 weeks,and the difference was significant (31.4％ vs 68.6％,x2 =0.560,P ＜0.01).Asphyxia at birth was the main risk factors of term and near term with RDS (OR =7.306,95％CI:0.018-51.101,P =0.041).Compared to the infants whom born without asphyxia,the infants born with asphyxia usually came out to RDS right after born (x2 =0.080,P ＜ 0.01),required longer time of mechanical ventilation and had significant lower effective ratio (x2 =0.071,8.843,all P ＜ 0.01).Conclusions Asphyxia is the first manifestations of term and near term infants with RDS.These infants often can be onset after birth.

In the present study, an ultra performance liquid chromatography coupled with time-of-fight mass spectrometry (UPLC-TOF/MS) based chemical profiling approach was used to evaluate chemical constitution between co-decoction and mixed decoction of ginseng and Radix Aconiti Praeparata. Two different kinds of decoctions, namely co-decoction of ginseng and Radix Aconiti Praeparata: water extract of mixed two herbs, and mixed decoction of ginseng and Radix Aconiti Praeparata: mixed water extract of each individual herbs, were prepared. Batches of these two kinds of decoction samples were subjected to UPLC-TOF/MS analysis. The datasets of t(R) m/z pairs, ion intensities and sample codes were processed with supervised partial least squared discriminant analysis (OPLS-DA) to holistically compare the difference between these two decoction samples. Significant difference between the two decoction samples was showed in the results of positive ion mode. The contents of hypaconitine and deoxyaconitine decreased, while that of benzoylmesaconine, benzoylhypaconine and dehydrated benzoylmesaconine increased in the samples of co-decoction of ginseng and Radix Aconiti Praeparata. The content of diester-diterpenoid alkaloids decreased, while that of monoester-diterpenoid alkaloids increased, which is probably the basis of toxicity-attenuated action when combined ginseng with Radix Aconiti Praeparata.

Objective To explore the effect of the prevention and treatment of unstable bladder after suprapubic prostaectomy by capsaicin instilled into the bladder preoperatively combined with patient-controlled epidural analgesia(PCEA)for benign prostatic hyperplasia(BPH).Methods Sixty patients with BPH underwent suprapubic prostatectomy under epidural anesthesia were randomly divided into control group (30 cases)and treatment group(30 cases),100 ml of 100 μmol/L capsaicin was instilled into the bladder preoperatively for 30 minutes combined with PCEA after operation in treatment group,the control group was only given PCEA.Observed the incidence and continuous time of unstable bladder after operation in two groups.Results Unstable bladder was found in 3 cases of treatment group and they were Ⅰdegree,12 cases happened unstable bladder in control group,3 cases Ⅰdegree,5 cases Ⅱdegree,3 cases Ⅲ degree,1 case Ⅳ degree.There was obvious significance between two groups (P＜0.05).Conclusion Capsaicin instilled into the bladder combined with PCEA can cut off the reflex arc of detrusor contraction more completely and has obvious effect of decrease the incidence of unstable bladder after suprapubic prostatectomy and can be used widely.

Objective To evaluate the respiration-induced target volume motion in 3D-CRT for mid-thoracic esophageal carcinoma in order to guide the radiation oncologist to choose the expansion marginfor ITV.Methods Ten patients with mid-thoracic esophageal carcinoma were scanned by multi-spiral CTsimulator respectively in free breathing(FB),breath.hold after normal inspiration and expiration(IBH and EBH)with the same scanning range.Then the CT images of three series were transfefred to the treatmentplanning system.The target volume was outlined following the same standard.The motion of the centerpoint of GTV,the center point of each slice of GTV and the edge of the GTV in selected slice weremeasured respectively to obtain the comprehensive value of GTV motion。in order to find the appropriate IMvalue according to the 95％confidence interval of the GTV motion.Results①The GTV motion betweenIBH and EBH was(0.19±0.16)cm in the left.right direction,(0.54±0.19)cm in the cranial andcaudal irection.and(0.16±0.14)cm in anterior.posterior directions for the center of GTV,.For thecenter point of each slice of GTV.they ere(0.19±0.15)cm,(0.54±0.16)cm,(0.16±0.13)cm in three directions above.respectively.For the edge of the GTV in selected slice.they were(0.26±0.19)cm,(0.54±0.18)cm,(0.24±0.19)cm,respectively.The comprehensive value of GTV motion between IBH and EBH was(0.23±0.17)cm,(0.54±0.17)cm,(0.21±0.17)cm.respectively.The 95％confidence interval was 0.21-0.25 cm.0.53-0.56 cm and 0.19-0.22 cm in three directions.②The direction of GTV motion：No motion was noticed in 8.2％.while 73.3％to the right side and 18.5％to the left side in the left-right direction when IBH were compared with EBH.100％were moved to caudal in the the cranial and caudal direction[(0.54±0.17)cm].In the anterior-posterior direction,no motion was noticed in 8.2％,while 16.6％to the posterior and 75.2％to the anterior when IBH were compared with EBH.③The GTV motion was correlated with the vafiance of 1ung volumes in IBH-EBH(r=0.683,P=0.032)and not with GTV volume and length.Conclusions Respiration can induce target volume motion in 3 DCRT for mid-thoracic esophageal carcinoma.Compared to EBH.the GTV tends to move to the caudal,the anterior and the ight side in IBH.

Objective To compare the efficacy and safety of full-thickness peroral endoscopic myotomy (POEM) and circular myotomy for patients with severe achalasia.Methods The clinical data of 123 patients with severe achalasia who were admitted to the Second Xiangya Hospital of Central South University from August 2011 to May 2013 were retrospectively analyzed.Seventy patients who received full-thickness POEM were in the full-thickness myotomy group,and the other 53 patieuts who received circular myotomy were in the circular myotomy group.The clinical efficacies and incidences of complications of the 2 groups were compared.Patients in the 2 groups were followed up at the out-patient department till May 2014.The consecutive measurement data were presented by (x) ± s and analyzed using thc t test; the non-consecutive data were presented by M (range) and analyzed using the Wilcoxon rank test.Data before and after operation were compared using the repeated measure of analysis of variance.The count data were analyzed using the chi-square test.Results All the patients successfully received POEM.The operation time of the full-thickness myotomy group and the circular myotomy group were (57 ± 8)minutes and (63 ± 12)minutes,with significant difference between the 2 groups (t =3.421,P ＜0.05).The incidences of complications of the full-thickness myotomy group and the circular myotomy group were 14.3％ (10/70) and 11.3％ (6/53),with no significant difference between the 2 groups (x2=0.234,P ＞0.05).Atotal of 119 patients were followed up,with the median time of 18 months (range,12-24 months).The Eckardt scores at postoperative month 6 and 12 were 0 (range,0-3) and 0 (range,0-3) in the full-thickness myotomy group,and 0 (range,0-2) and 0 (range,0-3) in the circular myotomy group,with no significant difference between the 2 groups (Z =0.525,1.476,P ＞ 0.05).The sussess rates of the full-thickness myotomy group and the circular myotomy group were 98.6％ (69/70) and 98.1％ (52/53),with no significant difference between the 2 groups (x2=0.040,P ＞ 0.05).The diameters of the esophagus at postoperative month 6 of the full-thickness myotomy group and the circular myotomy group were (3.2 ± 0.3) cm and (3.4 ± 0.4) cm,with no significant difference between the 2 groups (t =1.927,P ＞ 0.05).The diameters of the esophagus at postoperative month 6 and 12 were significantly lesser than (5.9 ± 1.0) cm and (5.9 ± 1.0) cm before operation (F =780.923,493.018,P ＜ 0.05).No recurrence was detected in the 2 groups during the follow-up.Conclusion The short-term efficacy and incidence of complications of full-thickness myotomy and circular myotomy are comparable,while the operation time of patients who received full-thickness myotomy is shorter.