Humans ; Hydrogen Sulfide ; poisoning ; Male ; Methylene Blue ; therapeutic use ; Poisoning ; therapy ; Young Adult

Child ; Humans ; Karyotyping ; Male ; Osteochondrodysplasias ; classification ; diagnosis ; genetics

Bone Neoplasms ; diagnosis ; pathology ; Breast Neoplasms ; diagnosis ; pathology ; Delayed Diagnosis ; Diagnostic Errors ; Female ; Frozen Sections ; Humans ; Intraoperative Period ; Retrospective Studies ; Thyroid Neoplasms ; diagnosis ; pathology

Objective To investigate the characteristics of the preoperative and postoperative urodynamical parameters of women with uterine cervical carcinoma after radical hysterectomies.Methods Forty-six women had uterine cervical carcinoma at stage Ⅰ b or Ⅱ a.Complete pre-and postoperative urodynamie follow-ups were conducted for each patient.Results Twenty-six women(57%)who had preoperatively normal urinary tract function needed to void by abdominal straining after radical surgery.After the radical hysterectomy,the postvoid residual volume[(205?201)vs(5?3)ml,P

Objective To explore the influence of lamotrigine(LTG)and valproate(VAP)on cognitive function in children with epilepsy.Methods Seventy-six epileptic children firstly diagnosed were chosen,36 cases received LTG monotherapy and 40 cases undwent the treatment of VPA.The intelligence quotient(IQ)value was measured before and after 6 months treatment respectively,and 20 healthy children were selected as healthy control.Results 1.The epileptic children had poor verbal intelligence quotient(VIQ),performance intelligence quotient(PIQ)and full intelligence quotient(FIQ)compared to the control subjects(Pa0.05).But among the subtestings,the know-ledge,wood-graph,coded score of the VPA groups had significant difference(Pa

OBJECTIVETo explore the effects of nano-hydroxyapatite/polyamide 66 (n-HA/PA66) cage on recovering and maintaining lumbar curvature, lumbar heights and fusion rate when used in the transforaminal lumbar interbody fusion.

METHODSFrom February to July 2012, 50 patients with degenerative lumbar disease(lumbar disc herniation in 32 cases and lumbar spondylolisthesis in 18 cases) were treated with transforaminal lumbar interbody fusion using the n-HA/PA66 cage, and their preoperative and postoperative clinical outcomes were analyzed. The patients were followed up for 2, 4, 6 and 8 months after operation, during which the CR and CT film of lumbar vertebra were checked to get relative height of vertebral space, Taillard index,index of lumbar spinal curvature,angle of segmental and full lumbar lordosis. The data were analyzed respectively with pair t-test, analysis of variance or LSD-t-test.

RESULTSAll the patients were followed up, and the duraion ranged from 8 to 13 months, with a mean of 11.32 months. There were significant differences in relative height of vertebral space, Taillard index, index of lumbar spinal curvature, angle of segmental and full lumbar lordosis after surgery, but there were no significant differences in different periods after operation. The fusion time of lumbar ranged from 4 to 8 months.

CONCLUSIONThe n-HA/PA66 cage can recover and maintain lumbar normal stability with higher rate of fusion and less complications.

Adult ; Durapatite ; administration & dosage ; Female ; Humans ; Intervertebral Disc Displacement ; surgery ; Lumbar Vertebrae ; surgery ; Male ; Middle Aged ; Nylons ; Spinal Fusion ; adverse effects ; instrumentation ; methods ; Spondylolisthesis ; surgery ; Tomography, X-Ray Computed

Adenocarcinoma ; metabolism ; secondary ; Adult ; Aged ; CDX2 Transcription Factor ; Carcinoma, Signet Ring Cell ; metabolism ; pathology ; Colonic Neoplasms ; metabolism ; pathology ; Cystadenocarcinoma, Mucinous ; metabolism ; pathology ; Cystadenocarcinoma, Serous ; metabolism ; pathology ; Diagnosis, Differential ; Female ; Homeodomain Proteins ; metabolism ; Humans ; Keratin-20 ; metabolism ; Keratin-7 ; metabolism ; Middle Aged ; Ovarian Neoplasms ; metabolism ; pathology ; secondary ; Trans-Activators ; metabolism ; Young Adult

Objective To establish an ultraviolet-irradiation damage model in cultured fibroblasts derived from human skin and to explore the potential protective effects and mechanisms of amyloid precursor protein 17-met peptide (APP17-mer peptide) on the oxidative damage and collagen metabolism in cultured fibroblasts after ultraviolet irradiation. Methods Human dermal fibroblast cultures were established by outgrowth from foreskin biopsies of a healthy donor and were irradiated by a single exposure to ultraviolet rays and cultured in a series of concentrations of APP17-mer peptide (0, 20, 40, 80 μmol/L).The activity of fibroblasts was detected by the assay of MTT. The intracellular ROS level was measured with a confocal microscope. The expression of MMP-1 mRNA was analyzed real-time quantitatively following RT-PCR. Results Primary cultures of human skin fibroblasts were established from human foreskin in DMEM supplemented with 10 % fetal bovine serum. UV irradiation depressed cellular activity and increased intracellular level of ROS (P<0.05). 40μmol/L and 80μmol/L APP17-mer peptide increased the cellular activity in both UV irradiated fibroblasts and unirradiated fibroblasts (P<0.05), however,20 μmol/L did not show such protective effects (P>0. 05). 40μmol/L APP17-mer peptide could depress the level of ROS in irradiated libroblasts. A single exposure of fibroblasts to UV irradiation resulted in 1.78 foldup-regulation of MMP-1 mRNA compared with unirradiated sample, 40μmol/L and 80μmol/L APP17-mer peptide decreased the expression of MMP-1 mRNA (P<0.05 and P<0.01, respectively).Conclusion APP17-mer peptide can enhance cellular activity under UV-induced oxidative stress and in-hibit collagen degradation in fibroblasts irradiated with ultraviolet rays. Inhibition of ROS production may be involved in the protective mechanism of APP17 peptide.

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant ; genetics ; physiology ; Phenylalanine Ammonia-Lyase ; genetics ; Plant Proteins ; genetics ; Promoter Regions, Genetic ; genetics ; Regulatory Sequences, Nucleic Acid ; genetics

OBJECTIVETo analyze the reasons why anterior decompression and titanium mesh fusion for cervical spondylosis always show poor therapeutic effects, and to investigate the clinical effects of anterior revision surgery in these patients.

METHODSFrom January 2004 to December 2011, 16 patients underwent anterior decompression and titanium mesh fusion for cervical myelopathy were treated with anterior revision surgery. There were 7 males and 9 females with an average age of 61 years old (ranged from 46 to 75 years), including 11 cases with cervical spondylotic myelopathy, 2 cases with nerve root cervical spondylosis and 3 cases with mixed type cervical spondylosis. Average duration from the first operation to reoperation was 7 years(ranged from 4 to 12 years). In the first operation, titanium mesh segment located in C3-C5 (2 cases), C4-C6 (8 cases), C4-C7 (2 cases), C5-C7 (4 cases), and one of them, titanium mesh implantation in C4 and C5,6 intervertebral disk removal and cage fusion. After the first operation, symptom of 13 patients recurred after improvement or disappearance, 2 patients did not show obvious improvement, and 1 patient aggravated. Cervical spine radiography, CT scan and MRI were performed in all patients before re-operation. There were 12 patients with compression of the spinal cord or nerve root caused by degenerative changes in adjacent segments of fusion segments, 4 cases in upper segments, and 8 cases in lower segments; 3 patients with compression of the spinal cord or nerve root caused by vertebral posterior osteophyte of decompressed segments; 1 patient with compression of the spinal cord caused by incomplete anterior decompression. JOA, NDI and Odom classification were used to assess the clinical effects.

RESULTSAll anterior revision surgery were successful with a mean time of 110 min (80 to 150 min) and mean bleeding of 160 ml (30 to 200 ml). There was 30 ml clear drainage fluid in 1 patient suspected of cerebrospinal fluid leakage. But the 2nd day after operation, the tube was removed and the drainage opening was sutured, and the suture incision healed in grade A after 10 days. Other patients had no complications such as dysdipsia, hoarseness, and laryngeal edema, etc. All patients were followed up for 12 to 28 months with an average of 16 months. Two months after operation and at last follow-up, JOA scores and ODI index had obviously improved than preoperation (P < 0.01), and there was significant difference between postoperative 2 months and last follow-up (P < 0.01). At the final follow-up, improvement rate of JOA was (72.9 +/- 0.2)%. According to the standard of Odom, 12 cases got excellent results, 3 good, 1 fair.

CONCLUSIONAfter surgery of cervical decompression and bone graft fusion with titanium mesh, the patients need re-operation because of incomplete decompression, degenerative changes in adjacent segments or newly formed compression factors, and complications caused by implants. Anterior revision surgery can obtain good clinical effects.

Aged ; Cervical Vertebrae ; surgery ; Decompression, Surgical ; methods ; Female ; Humans ; Male ; Middle Aged ; Reoperation ; Spinal Fusion ; methods ; Spondylosis ; surgery ; Surgical Mesh ; Titanium