2.Report of a case with Schwardz-Jampel syndrome.
Rong QIANG ; Hui-ping SHI ; Wei YU
Chinese Journal of Pediatrics 2003;41(6):456-456
Child
;
Humans
;
Karyotyping
;
Male
;
Osteochondrodysplasias
;
classification
;
diagnosis
;
genetics
4.Urodynamic study of lower urinary tract function after radical hysterectomy in postoperative women of cervical cancer
Hui-Rong SHI ; Xiao-Feng YANG ; Jian-Guo WEN ;
Chinese Journal of Obstetrics and Gynecology 2000;0(12):-
Objective To investigate the characteristics of the preoperative and postoperative urodynamical parameters of women with uterine cervical carcinoma after radical hysterectomies.Methods Forty-six women had uterine cervical carcinoma at stage Ⅰ b or Ⅱ a.Complete pre-and postoperative urodynamie follow-ups were conducted for each patient.Results Twenty-six women(57%)who had preoperatively normal urinary tract function needed to void by abdominal straining after radical surgery.After the radical hysterectomy,the postvoid residual volume[(205?201)vs(5?3)ml,P
5.Influence of Lamotrigine and Valproate on Cognitive Function in Children with Epilepsy
guan-hui, LI ; rong-fu, SHI ; rong, WANG ; gui-xiang, PANG ; jian-ying, LI ; qing-hua, LI
Journal of Applied Clinical Pediatrics 2004;0(12):-
Objective To explore the influence of lamotrigine(LTG)and valproate(VAP)on cognitive function in children with epilepsy.Methods Seventy-six epileptic children firstly diagnosed were chosen,36 cases received LTG monotherapy and 40 cases undwent the treatment of VPA.The intelligence quotient(IQ)value was measured before and after 6 months treatment respectively,and 20 healthy children were selected as healthy control.Results 1.The epileptic children had poor verbal intelligence quotient(VIQ),performance intelligence quotient(PIQ)and full intelligence quotient(FIQ)compared to the control subjects(Pa0.05).But among the subtestings,the know-ledge,wood-graph,coded score of the VPA groups had significant difference(Pa
6.Application of teacher standard patient in OSCE inquisition examination of college nursing students
Li-Rong SHI ; Jie ZHENG ; Hui-Rong ZHANG
Chinese Journal of Modern Nursing 2010;16(10):1185-1186
Objective To explore the application effects of nursing teacher standard patient (TSP) to objective structured clinical examination (OSCE).Methods Students were given a mark from aspects of inquisition score table,nursing evaluation,nursing diagnosis,nursing plan and health education.Then examination results were analyzed.Results The data were normal distribution.The evaluation results were objective and effective.Conclusions Using TSP to evaluate nursing students is helpful for them to cultivate their clinical thinking model of taking patients as the centre.
7.Transcription factor SP1 decoy ODNs targeting α1, 3-GT renders porcine endothelial cells resistant to complement-mediated cytotoxicity
Yabing HUANG ; Lu WANG ; Zhuzeng YIN ; Rong LI ; Hui GUO ; Shi CHEN
Chinese Journal of Organ Transplantation 2008;29(10):594-597
Objective To investigate whether porcine endothelial cells transfected with SP1 de-coy ODNs could resist complement-mediated cytotoxicity during the model of SV-40-PED with human serum in vitro. Methods Immortalized porcine aortic endothelial cells of the line PED were divided in-to three groups. The transfected group was SV-40-PED with SP1 decoy ODNs. The mismatched group was SV-40-PED with scrambled SP1 decoy ODNs. The negative group was cells with oligo-fectamine only. The expression of α1,3-GT mRNA and αGal was detected after 26 h by using fluores-cence microscope, Western blot, RT-PCR and lactate dehydrogenase (LDH) activity assay. Results Fluorescence microscopy observed the decreased fluorescence of αGal after SP1 decoy ODNs transfec-tion. Dotted fluorescent decrease could be observed on some membrane while the mismatched group and negative group with bright green fluorescence. Western blot showed that the average absorbance of the PED cells transfected with decoy ODNs was decreased to 52.6% of the negative group (P<0.05). The expression of α1,3-GT mRNA in the PED cells transfected with decoy ODNs was 0.42±0.20 (isoform 1) and 0.27±0.12 (isoform 2) respectively, significantly lower than in the negative group (isoform 1, 0.72±0.17; isoform 2, 0.50±0.19; both P<0.05). The expression of α1, 3-G Tin the mismatch group was not different from that in the negative group (P>0.05). 20% normal hu-man serum (NHS) and 40 % NHS had cytotoxic effect on both mismatch and negative groups, but de-coy ODNs could confer SV-40-PED protection from the cytolysis effect (P<0.05), which made a re-markable reduction of complement-mediated cytotoxicity towards SV-40--PED. Conclusions SP1 decoy ODNs could confer porcine endothelial cells protection from complement-mediated cytotoxicity effect in vitro.
8.Detection of CDX-2, CK7 and CK20 in primary and metastatic ovarian carcinoma.
Zhong-fu YUAN ; Hui-rong SHI ; Hong-min SUN ; Wen-cai LI
Chinese Journal of Pathology 2007;36(8):555-556
Adenocarcinoma
;
metabolism
;
secondary
;
Adult
;
Aged
;
CDX2 Transcription Factor
;
Carcinoma, Signet Ring Cell
;
metabolism
;
pathology
;
Colonic Neoplasms
;
metabolism
;
pathology
;
Cystadenocarcinoma, Mucinous
;
metabolism
;
pathology
;
Cystadenocarcinoma, Serous
;
metabolism
;
pathology
;
Diagnosis, Differential
;
Female
;
Homeodomain Proteins
;
metabolism
;
Humans
;
Keratin-20
;
metabolism
;
Keratin-7
;
metabolism
;
Middle Aged
;
Ovarian Neoplasms
;
metabolism
;
pathology
;
secondary
;
Trans-Activators
;
metabolism
;
Young Adult
9.Radiological study on the n-HA/PA66 cage used in the transforaminal lumbar interbody fusion.
Pei-ming SANG ; Ming ZHANG ; Bin-hui CHEN ; Chang CAI ; Shi-rong GU ; Min ZHOU
China Journal of Orthopaedics and Traumatology 2014;27(8):654-657
OBJECTIVETo explore the effects of nano-hydroxyapatite/polyamide 66 (n-HA/PA66) cage on recovering and maintaining lumbar curvature, lumbar heights and fusion rate when used in the transforaminal lumbar interbody fusion.
METHODSFrom February to July 2012, 50 patients with degenerative lumbar disease(lumbar disc herniation in 32 cases and lumbar spondylolisthesis in 18 cases) were treated with transforaminal lumbar interbody fusion using the n-HA/PA66 cage, and their preoperative and postoperative clinical outcomes were analyzed. The patients were followed up for 2, 4, 6 and 8 months after operation, during which the CR and CT film of lumbar vertebra were checked to get relative height of vertebral space, Taillard index,index of lumbar spinal curvature,angle of segmental and full lumbar lordosis. The data were analyzed respectively with pair t-test, analysis of variance or LSD-t-test.
RESULTSAll the patients were followed up, and the duraion ranged from 8 to 13 months, with a mean of 11.32 months. There were significant differences in relative height of vertebral space, Taillard index, index of lumbar spinal curvature, angle of segmental and full lumbar lordosis after surgery, but there were no significant differences in different periods after operation. The fusion time of lumbar ranged from 4 to 8 months.
CONCLUSIONThe n-HA/PA66 cage can recover and maintain lumbar normal stability with higher rate of fusion and less complications.
Adult ; Durapatite ; administration & dosage ; Female ; Humans ; Intervertebral Disc Displacement ; surgery ; Lumbar Vertebrae ; surgery ; Male ; Middle Aged ; Nylons ; Spinal Fusion ; adverse effects ; instrumentation ; methods ; Spondylolisthesis ; surgery ; Tomography, X-Ray Computed
10.Vascular-specific promoters and cis-regulatory elements.
Chinese Journal of Biotechnology 2003;19(2):131-135
Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.
Gene Expression Regulation, Plant
;
genetics
;
physiology
;
Phenylalanine Ammonia-Lyase
;
genetics
;
Plant Proteins
;
genetics
;
Promoter Regions, Genetic
;
genetics
;
Regulatory Sequences, Nucleic Acid
;
genetics