Objective　To find out the morbidity and main pathogens of ventilator-associated pneumonia(VAP) in PICU.Methods　44 VAP cases were reviewed.Results　44 VAP cases were diagnosed and analyzed from 1998, 2 to 2001,1,the morbidity of VAP was 69.8%.The predominant pathogen was Pseudomonas aeruginosa.Conclusion　It has reference value in consideri ng the possible pathogens of pneumonia.

Small for gestational age ( SGA ),one of the major adverse pregnancy outcomes, significantly increases the risk of perinatal death and metabolic diseases in adulthood. It is of great significance to strengthen early surveillance and intervention for SGA prevention. Dyslipidemia during pregnancy, as a common metabolic disorder, has been considered to correlate with the increased risk of SGA; however, the epidemiological evidence is still controversial. We have systematically reviewed the recent studies related to the association between serum lipid level during pregnancy and the risk of SGA, so as to provide reference for prevention and intervention of SGA.

Objective To investigate the antitumour effects of transfected gut-enriched Krüppellike factor(GKLF) on human gastric carcinoma cell line SGC-7901 in vitro and in vivo. Methods The expression of GKLF mRNA and protein in human gastric carcinoma cell line SGC-7901 were detected before and after transfection by real-time fluorescence quantitative PCR and Western blot,respectively. Proliferation and invasion in SGC-7901 were measured respectively by MTT assay, flow cytometry, colony formation assay and cell invasion assay after transfected with GKLF. The growth of xenograft was observed, the microvessel density(MVD) of xenograft tissue was determined by immunohistochemistry. Results The GKLF mRNA and protein in SGC-7901 were overexpressed after transfected with GKLF(P＜0.05). The proliferative speed of SGC7901-pcDNA3.1-GKLF group was markedly lower than that of SGC-7901 and SGC7901-pcDNA3.1 groups (P＜0.05). Transfected with GKLF caused part of the G0/G1 arrest, decreased clone formation rate and the invasion ability (P＜0.05). The growth speed of xenograft in SGC7901-pcDNA3.1-GKLF group was lower, the weight and MVD of xenograft tissue in SGC7901-pcDNA3. 1-GKLF group were less (P＜ 0. 05).Conclusion Transfected with GKLF maysuppress proliferation and invasion in human gastric carcinoma cell line SGC-7901, inhibit the growth and the angiogenesis of xenograft in nude mice.

Objective To investigate the status of knowledge and performance on Chinese Heart Failure Diagnosis and Treatment Guideline (2014 version) in general practitioners of Shanghai Pudong communities.Methods The survey was conducted from April to June in 2014 with a self-designed questionnaire.Total 390 general practitioners (GPs) in Pudong New Area were selected by cluster sampling method.The contents of questionnaire included:diagnosis and differential diagnosis,drug therapy,non drug therapy of chronic heart failure.Result Total 385 questionnaires were retrieved with a response rate of 98.7％ (385/390).The results showed that in aspect of diagnosis and differential diagnosis,373 (96.9％) Gps made the diagnosis based on history and physical examination,171 (44.4％)Gps never used BNP or NTPro-BNP tests,280 (72.7％)GPs did not know how to identify systolic or diastolic heart failure,86 (22.3％)Gps made the differential diagnosis according to the EF value.In aspects of drug therapy,the rate of beta blockers use was 10％-30％ in 284 (73.8％) Gps,149 (38.7％) Gps did not use beta blockers because of not knowing the contraindications,289 (75.1％) Gps used a maximum dose of betaloc for 25-50 mg,no one used 101-200 mg,242 (62.9％)Gps did not know the target dose of betaloc,the rate of ACEI/ARB use was 10％-30％ in 330 (85.7％) Gps,258 (67.0％) Gps would increase the dose but not knowing the target dose.The main reason for not using the target dose of Betaloc and ACEI/ARB was not knowing the dose.In aspect of non-drug therapy:240 (62.3％)Gps never heard of cardiac resynchronization therapy (CRT) and 271 (70.4％)Gps never heard of implantable cardioverter defibrillator (ICD).The senior rank GPs grasped the guideline much better than Gps with primary and intermediate professional ranks.Conclusion General practitioners in community health centers should further study the guideline of heart failure,particularly need to strengthen the knowledge and ability of drug therapy.

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

Objective To study the effect of total nutrient admixture (TNA) on lipid metabolism in rats with acute hepatic failure (AHF). Methods Fifty-six male Wistar rats were randomly divided into four groups: normal diet group, nitrogen-free diet group, fat-free nutrient admixture group, and TNA group. All rats were injected with D-galac- tosamine to induce AHF model Meanwhile, 6 healthy Wistar rats were used as control group. TNA provided energy 221.75 kJ (1 kcal=4.184 kJ), nitrogen 0.365 g, nitrogen to energy ratio 1:145, amino acids 2.28 g (including branched-chain amino acid 0.70 g), glucose 7.85 g, and fat 1.25 g on a daily basis. After 10 days of the operation of Jugular vein puncture tube, blood glucose, blood lipid, liver and renal function were determined. Results The blood glucose level was significantly higher in TNA group than that in fat-free nutrient admixture group (P < 0.05). The levels of serum triglyceride and cholesterol were highest in fat-free nutrition admixture group, and triglyceride level was signif- icantly higher than that in normal diet group and nitrogen-free diet group (P <0.05). The levels of serum triglyceride and cholesterol were significantly higher in TNA group than those in normal diet group (P <0.05). The levels of ala- nine aminotransferase, alkaline phosphatase, total bilirubin and blood urea nitrogen were lower in TNA group than those in fat-free nutrient admixture group (P < 0.05). Conclusion The nutritional proportion of TNA is suitable for the metabolism disorder of hepatic failure, and therefore TNA can reasonably promote the anabolism and reverse the deteri- oration of hepatic failure in rats.

Cartilage antuumor component (CATC) was isolated from a 1 mol/L guanidine hydrochloride extract of bovine cartilage by acetone fractioned precipitation and superfiltration. Using human skin fibroblasts as a normal control, it was demonstrated that CATC inhibited the DNA synthesis of Hela, QGY7703 tumor cell lines and bovine artery endothelial cells, but accelerated the normal cells, when the concentration was below 1250 ?g/ml. At the concentration of 5 000 ?g/ml, CATC inhibited the two cell lines. With human tumor stem cell assay, CATC inhibited the stem cell growth of Hela and QGY7703 cell lines. These suggest that CATC has the effects of inhibiting angiogenesis and tumor cells.

Recent studies suggested that the prostate cancer may arise from prostate cancer stem cells that share some same characteristics with normal stem cells. The purpose of this study was to detect the differences of Nanog expression between PC3 prostate cancer cell line and its tumor stem cells, and the relationship was preliminarily examined between Nanog and prostate cancer and its tumor stem cells. By using magnetic active cell sorting (MACS), we isolated a population of CD44(+)/CD133(+) prostate cancer cells that display stem cell characteristics from PC3 cell line. Immunohistochemistry revealed positive expressions of CD44, CD133 and α(2)β(1)-integin in the isolated cells. CCK-8 analysis showed that isolated cells had a strong proliferative ability. The formation of the cell spheres in serum-free medium and holoclones in serum-supplied medium showed that the cells were capable of self-renewing, indicating that the isolated cells were a population of cancer stem-like cells derived from PC3 cell line. Western blotting exhibited that the isolated cells had higher experession of Nanog, an embryonic stem marker, as compared with PC3 cells. Our study showed that Nanog might be helpful in sustaining the self-renewal and the undifferentiation of prostate cancer stem cells, and may serve as a marker for prostate cancer stem cells for isolation and identification.

Object To study the chemical constituents of cytotoxicity portion in the bark of Reevesia longipetiolata Merr et Chun Methods The constituents were isolated and purified by various chromatographic methods, such as gel column chromatography under normal pressure and increased pressure, Sephadex LH 20 column chromatography and HPLC, and the structures were identified by physicochemical properties and spectral analysis Results Five compounds were obtained in the ethyl acetate fractions and identified as ? sitosterol (Ⅰ), daucosterol (Ⅱ), betulinic acid (Ⅲ), lupeol (Ⅳ) and (+) catechin (Ⅴ) Conclusion All above compounds are obtained from the plants of Reevesia Lindl for the first time, and their cytotoxicity is discussed

As a kind of additive in feed of monogastric animals, the application of natural phytase is limited due to its disadvantages. In this paper, the strategies of phytse reform was introduced. Furthermore, the research and progress on protein engineering of feed phytase was reviewed, including phytase over-expression, phytase thermostability, catalytic efficiency and optimum pH.