Objective　To find out the morbidity and main pathogens of ventilator-associated pneumonia(VAP) in PICU.Methods　44 VAP cases were reviewed.Results　44 VAP cases were diagnosed and analyzed from 1998, 2 to 2001,1,the morbidity of VAP was 69.8%.The predominant pathogen was Pseudomonas aeruginosa.Conclusion　It has reference value in consideri ng the possible pathogens of pneumonia.

Small for gestational age ( SGA ),one of the major adverse pregnancy outcomes, significantly increases the risk of perinatal death and metabolic diseases in adulthood. It is of great significance to strengthen early surveillance and intervention for SGA prevention. Dyslipidemia during pregnancy, as a common metabolic disorder, has been considered to correlate with the increased risk of SGA; however, the epidemiological evidence is still controversial. We have systematically reviewed the recent studies related to the association between serum lipid level during pregnancy and the risk of SGA, so as to provide reference for prevention and intervention of SGA.

Objective To investigate the antitumour effects of transfected gut-enriched Krüppellike factor(GKLF) on human gastric carcinoma cell line SGC-7901 in vitro and in vivo. Methods The expression of GKLF mRNA and protein in human gastric carcinoma cell line SGC-7901 were detected before and after transfection by real-time fluorescence quantitative PCR and Western blot,respectively. Proliferation and invasion in SGC-7901 were measured respectively by MTT assay, flow cytometry, colony formation assay and cell invasion assay after transfected with GKLF. The growth of xenograft was observed, the microvessel density(MVD) of xenograft tissue was determined by immunohistochemistry. Results The GKLF mRNA and protein in SGC-7901 were overexpressed after transfected with GKLF(P＜0.05). The proliferative speed of SGC7901-pcDNA3.1-GKLF group was markedly lower than that of SGC-7901 and SGC7901-pcDNA3.1 groups (P＜0.05). Transfected with GKLF caused part of the G0/G1 arrest, decreased clone formation rate and the invasion ability (P＜0.05). The growth speed of xenograft in SGC7901-pcDNA3.1-GKLF group was lower, the weight and MVD of xenograft tissue in SGC7901-pcDNA3. 1-GKLF group were less (P＜ 0. 05).Conclusion Transfected with GKLF maysuppress proliferation and invasion in human gastric carcinoma cell line SGC-7901, inhibit the growth and the angiogenesis of xenograft in nude mice.

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

Recent studies suggested that the prostate cancer may arise from prostate cancer stem cells that share some same characteristics with normal stem cells. The purpose of this study was to detect the differences of Nanog expression between PC3 prostate cancer cell line and its tumor stem cells, and the relationship was preliminarily examined between Nanog and prostate cancer and its tumor stem cells. By using magnetic active cell sorting (MACS), we isolated a population of CD44(+)/CD133(+) prostate cancer cells that display stem cell characteristics from PC3 cell line. Immunohistochemistry revealed positive expressions of CD44, CD133 and α(2)β(1)-integin in the isolated cells. CCK-8 analysis showed that isolated cells had a strong proliferative ability. The formation of the cell spheres in serum-free medium and holoclones in serum-supplied medium showed that the cells were capable of self-renewing, indicating that the isolated cells were a population of cancer stem-like cells derived from PC3 cell line. Western blotting exhibited that the isolated cells had higher experession of Nanog, an embryonic stem marker, as compared with PC3 cells. Our study showed that Nanog might be helpful in sustaining the self-renewal and the undifferentiation of prostate cancer stem cells, and may serve as a marker for prostate cancer stem cells for isolation and identification.

Objective To determine the prevalence and clinical features of peripancreatic vascular abnormalities in patients with pancreatitis.Methods The clinical data of 102 pancreatitis patients between January 2013 to December 2014 in the General Hospital of Shenyang Military Command who underwent contrast enhanced CT or contrast enhanced MRI scans were retrospectively analyzed.The radiological features of peripancreatic vascular abnormalities in such patients were examined, and the clinical features of pancreatitis patients with or without peripancreatic vascular abnormalities were investigated.Results Peripancreatic vascular abnormalities were found in 18 patients(17.6%), and vascular abnormalities were relatively common in portal vessels.No significant differences were observed on the age at onset, gender ratio, smoking status, alcohol consumption and length of stay between patients with and without peripancreatic vascular abnormalities.Compared with those without peripancreatic vascular abnormalities, patients with peripancreatic vascular abnormalities had a significantly higher incidence of peripancreatic fluid collection, pancreatic pseudocyst and gastric varices, and the differences were statistically significant(all P<0.05).Conclusions Peripancreatic vascular abnormalities can be complicated with pancreatitis.Enhanced CT or enhanced MRI were valuable in the diagnosis.Pancreatic pseudocyst, peripancreatic fluid collection and gastric varices were more common in pancreatitis complicated with peripancreatic vascular abnormalities.

Objective To observe the acupoint massage on gestational diabetes about mellitus and pregnancy outcome.Methods Using simple random sampling method,96 cases of gestational diabetes mellitus were randomly divided into the observation group and control group.The control group were given the conventional treatment, the observation group were given acupoint massage,pregnancy outcomes and blood glucose in the two groups before and after intervention were compared.Results The two groups after treatment of fasting blood glucose,2h postprandial blood glucose and glycated hemoglobin levels were significantly lower than that those of before treatment, but the observation group[(6.92 ±0.66)mmol/L,(8.12 ±0.70)mmol/L,(6.88 ±0.39)%]improved significantly better than those of the control group[(7.93 ±1.03)mmol/L,(9.54 ±1.33)mmol/L,(7.95 ±0.63)%],the difference was statistically significant(t =3.27,2.39,2.73,all P<0.05).The observation group after treatment,the 2H C peptide levels in fasting serum C peptide and postprandial[(0.50 ±0.07)nmol/L,(0.54 ±0.06)nmol/L]signifi-cantly increased than those of the control group after treatment[(0.38 ±0.04)nmol/L,(0.49 ±0.04)nmol/L],with statistical significant differences(t=2.41,2.15,P<0.05).The patients in the control group after treatment,statistical average daily insulin dosage was (55.84 ±8.73) u,the observation group was (32.24 ±5.03) u,the observation group was significantly lower than that of the control group,the difference was statistically significant(t=13.84,P<0.05).The observation group cesarean section,polyhydramnios,postpartum hemorrhage,fetal distress,pregnancy induced hypertension incidence rate(12.50%,4.17%,2.08%,4.17%,0%) were lower than those of the control group(29.17%,16.67%,12.50%,22.92%,12.50%),the difference was statistically significant(χ2 =4.042, 3.877,3.852,7.206,6.400,all P<0.05).Conclusion The acupoint massage therapy can effectively enhance the gestational diabetes treatment effect,improve the pregnancy outcome in patients with gestational diabetes mellitus.

Objective To study the effect of total nutrient admixture (TNA) on lipid metabolism in rats with acute hepatic failure (AHF). Methods Fifty-six male Wistar rats were randomly divided into four groups: normal diet group, nitrogen-free diet group, fat-free nutrient admixture group, and TNA group. All rats were injected with D-galac- tosamine to induce AHF model Meanwhile, 6 healthy Wistar rats were used as control group. TNA provided energy 221.75 kJ (1 kcal=4.184 kJ), nitrogen 0.365 g, nitrogen to energy ratio 1:145, amino acids 2.28 g (including branched-chain amino acid 0.70 g), glucose 7.85 g, and fat 1.25 g on a daily basis. After 10 days of the operation of Jugular vein puncture tube, blood glucose, blood lipid, liver and renal function were determined. Results The blood glucose level was significantly higher in TNA group than that in fat-free nutrient admixture group (P < 0.05). The levels of serum triglyceride and cholesterol were highest in fat-free nutrition admixture group, and triglyceride level was signif- icantly higher than that in normal diet group and nitrogen-free diet group (P <0.05). The levels of serum triglyceride and cholesterol were significantly higher in TNA group than those in normal diet group (P <0.05). The levels of ala- nine aminotransferase, alkaline phosphatase, total bilirubin and blood urea nitrogen were lower in TNA group than those in fat-free nutrient admixture group (P < 0.05). Conclusion The nutritional proportion of TNA is suitable for the metabolism disorder of hepatic failure, and therefore TNA can reasonably promote the anabolism and reverse the deteri- oration of hepatic failure in rats.

Cartilage antuumor component (CATC) was isolated from a 1 mol/L guanidine hydrochloride extract of bovine cartilage by acetone fractioned precipitation and superfiltration. Using human skin fibroblasts as a normal control, it was demonstrated that CATC inhibited the DNA synthesis of Hela, QGY7703 tumor cell lines and bovine artery endothelial cells, but accelerated the normal cells, when the concentration was below 1250 ?g/ml. At the concentration of 5 000 ?g/ml, CATC inhibited the two cell lines. With human tumor stem cell assay, CATC inhibited the stem cell growth of Hela and QGY7703 cell lines. These suggest that CATC has the effects of inhibiting angiogenesis and tumor cells.

Objective To evaluate the effect of electro-acupuncture pretreatment on endoplasmic reticulum stress during global cerebral ischemia-reperfusion (I/R ) in rats .Methods One hundred and forty-four adult male Sprague-Dawley rats ,weighing 400-500 g ,were randomly divided into 3 groups ( n=48 each) using a random number table:sham operation group (group S ) , I/R group and electro-acupuncture pretreatment group (group EA) .Global cerebral I/R was induced by 4-vessel occlusion method .Bilateral vertebral arteries were permanently occluded by cauterization and bilateral carotid arteries were occluded for 5 min , followed by reperfusion .Electro-acupuncture of Dazhui and Baihui acupoints lasting for 30 min was performed once a day for 5 consecutive days starting from 5 days before ischemia in group EA .At 6 ,12 ,24 and 48 h of reperfusion ,12 rats were sacrificed in each group and hippocampi were removed for microscopic examination and for determination of apoptosis rate (by TUNEL ) and expression of growth arrest-and DNA damage-inducible gene 153 (GADD153 ) protein (by Western blot ) .Results Compared with group S ,the apoptosis rate was significantly increased and the expression of GADD153 protein was up-regulated at 6 ,12 ,24 and 48 h of reperfusion in I/R and EA groups ( P<0.05) .Compared with group I/R ,the apoptosis rate was significantly decreased and the expression of GADD 153 protein was down-regulated at 6 ,12 ,24 and 48 h of reperfusion in group EA ( P< 0.05) .The pathological changes were significantly attenuated in group EA as compared with group I/R .Conclusion Electro-acupuncture pretreatment can down-regulate the expression of GADD 153 protein , reduce endoplasmic reticulum stress , and decrease cell apoptosis ,thus attenuating global cerebral I/R injury in rats .