Objective To study the effect of ketamine on L-type calcium currents (ICa-L) in guinea pig ventricular myocytes. Methods Adult guinea pigs of both sexes were anesthetized with pentobarbital. The hearts were immediately removed and ventricular myocytes were prepared by the technique described by Liu et al. The whole-cell patch clamp technique was used to study the ICa-L in isolated guinea pig ventricular myocytes. The changes in ICa-L produced by ketamine 100 ?mol?L-1 with different holding potentials or by different concentrations of ketamine with holding potential of + 10 mV were analyzed. Results Ketamine dose-dependently inhibited ICa-L evoked by a voltage step from a holding potential of - 40 mV to + 10 mV. The 4 concentrations of ketamine (100, 500, 1 000, 5 000 ?mol?L-1) reduced 1Ca-L by 28.7%?5.7% , 34.7%?1.4%, 58.7%?6.4% and 81.7%?6.7% respectively, with a mean IC50 concentration of 926.6 ?mol?L-1 . When the cells were exposed to ketamine 100 ?mol?L-1, the steady-state activation curve was not significantly affected, while the steady-state inactivation curve was shifted to more negative potentials.V1/2 decreased from ( - 14.8?0.8 ) mV to ( - 19.6?0.7) mV (P0.05) in control and drug-affected cells respectively. Ketamine slowed the rate of recovery from inactivation. Conclusion Ketamine can inhibit ICa-L in guinea pig ventricular myocytes in a concentration-dependent manner. This inhibitory effect of ketamine may explain its negative inotropic effect. Ketamine inhibits L-type calcium channel in its inactivated state.

BACKGROUND:Various surface modification techniques have been used to improve the bioactivity of titaniumimplant in vivo. OBJECTIVE:To investigate the effects of enamel matrix proteins (EMPs) on the growth of apatite coatings on dual thermo-etching treated pure titanium. METHODS:EMPs were extracted from porcine tooth germs and then were identified. Dual thermo-etching was applied to treat titanium samples fol owing polished, and then immersed in a blank simulated body fluid supersaturated calcification solution (control group) or supersaturated calcification solution containing different concentrations of EMPs for 7 days. The morphology of samples was observed using scanning electron microscope, and element components and crystal structures of the apatite coatings were analyzed by energy dispersive spectrometer and X-ray diffraction. RESULTS AND METHODS:After double-etching, a pit-like rough surface was observed on the titanium plate. After 7-day mineralization, in the control group, no overt calcium-phosphate deposits were found on the titanium surface;however, in the experimental groups, there were calcium-phosphate deposits, whose quantity and morphology changed with increasing concentrations. Energy dispersive spectrometer showed that the main element components of the mineralized coating included calcium, phosphorus, oxygen and carbon, and the calcium-phosphate ratio ranged from 1.32 to 1.41. The apatite coatings were proved to be carbonate hydroxyapatite by X-ray diffraction. To conclude, EMPs promote apatited deposition on pure titanium surfaces in a concentration-dependent manner.

0 05).Among the 13 patients with liver damage,AKP and ? GT were raised in 6,and AKP,? GT,TBIL and DBIL all elevated in 4 In 8 patients anti SMA and AMA were detected,and 5 showed AMA positive.Liver biopsy in 6 patients showed 3 with chronic active hepatitis among which 2 were complicated with liver cirrhosis,1 chronic persistent hepatitis and 2 cholangitis.Of the 6 patients 5 showed different degrees of infiltration of mononuclear cells in the portal tracts.Conclusion The occurrence of liver damage in pSS is rather high.The liver damage may be related to primary biliary cirrhosis (PBC).Patients′ response to corticosteroid treatment is favourable and their prognosis appears good.

0 05).Conclusion The standards of Amor and ESSG have higher sensitivity and specificity to diagnose spondyloarthropathy in China.The two standards have no difference in statistics.

Objective To investigate the clinical treatment of nonpenetrated cornea trauma caused by crops. Methods Clinical data of 128 cases of nonpenetrated cornea trauma caused by crops were retrospectively analyzed. According to the interval time between occurrence of trauma and clinic visiting, the patients were divided into 3 groups:group A (33 cases,<24 h), group B (72 cases, 24 h≤interval time<1 week) and group C (23 cases, ≥ 1 week). The therapeutic effects and prognosis were analyzed. Results There was statistical difference in the incidence of corneal ulcer among group A, group B and group C: 6.1% (2/33), 62.5% (45/72) and 100.0% (23/23), χ2= 52.32, P<0.01. In group B, 12 cases were treated with conjunctival flap covering, 2 cases received keratoplasty and 2 cases undertook enucleation. In group C, 10 cases were treated with conjunctival flap covering, 4 cases received keratoplasty and 2 patients undertook enucleation finally. All the other patients were cured with local debridement and medical treatment. Conclusions Patients with nonpenetrated cornea trauma caused by crops may develop infectious keratitis, and prompt and proper treatment can avoid the secondary infection and improve the outcome. Local debridement in combination with iodophors disinfection can prevent the incidence of infectious keratitis. Conjunctival flap covering is an effective technique in the treatment of corneal ulcer caused by nonpenetrated cornea trauma.

Objective To investigate the appropriate surgical procedure for unilateral papillary thyroid microcarcinoma (PTMC).Methods Clinical data of 323 patients with unilateral PTMC in Cancer Hospital of Chinese Academy of Medical Sciences from 1999-2007 were retrospectively studied.Survival outcomes and prognostic factors were analyzed.Results After a median follow-up of 102 (range,12-188) months,the 10-year overall and disease-specific survival was 95.3％ and 98.9％.The 10-year recurrence-free survival was 85.5％.The 10-year cumulative recurrence rate of residue glands was 6.5％.Capsular invasion,pT stage and clinical stage were significant predictive factors for recurrence of residue glands (all P ＜ 0.05).Cox regression multivariate analysis showed that pT stage (HR 2.153,95％ CI 1.231-3.767,P =0.007) was independent predictive factor.Of the 311 patients treated with non-total thyroidectomy,the 10-year cumulative recurrence rate of residue glands was 6.8％ Conclusions Unilateral PTMC has a good prognosis and hemithyroidectomy (lobectomy and isthmusectomy) is an appropriate surgical pattern.Extrathyroidal extension is a significant predictor for recurrence.

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

Objective To study whether ORF3 coded by fap1-orf4 gene locus of Streptococcus pa-rasanguis is involved in the regulation of Fap1 glycosylation and maturation and to investigate whether ORF3 influences Streptococcus parasanguis adhesion. Methods A gene replacement strategy was adapted to con-struct orf3 alleic replace mutant of Streptococcus parasanguis. Complementation assay and Western blot were used to test Fap1 expression levels. Whole saliva-coated hydroxyapatite (SHA) adhesion assay was adapted to determine Streptococcus parasanguis adhension. Results (1) Non-polar was found in strain VT1774, the orf3 alleic replace mutant of Streptococcus parasanguis. (2) Western blot showed that mature Fapl (Mr about 220 × 103) disappeared and were substituted with high molecular weight Fapl (Mr about 470 × 103) in strain VT1774, furthermore, complementation assay showed VT1775, the complementation strain of VT1774, re-stored mature Fapl expression. (3) The binding ability reduced significantly in strain VT1774. Conclusion ORF3 coded byfapl-orf4 gone locus was required for Fap1 glycosylation and maturation in Streptococcus pa-rasanguis, orf3 alleic replacment resulted in Fap1 glycosylation and mature disorder and decreasing of adhen-sion ability of Streptococcus parasanguis.

In the present study, the efficacy of Naoxintong capsule (NXT), a compound Chinese herbal medicine, combined with dual antiplatelet therapy (DA) in a rat model of coronary microembolization (CME) was evaluated.

Objective To determine the effect of cardiomyopeptidin on transient outward potassium current(I_(to) of rat ventricular myocytes and its action mechanism on the ion channels of myocardium.Methods Single ventricular myocytes of rats were obtained by enzymatic dissociation.The whole-cell patch-clamp recording technique was used to record the change of transient outward potassium current(I_(to) by different dosages of cardiomyopeptidin.Results Cardiomyopeptidin decreased I_(to) in a dose-dependent manner.Cardiomyopeptidin in dose of 10,50,100,250 and(500 mg/L) decreased I_(to %) by 4,13,22,32 and 38 respectively.Cardiomyopeptidin 50 mg/L moved the current density-voltage curve of I_(to) down,but the shape of the curve had no changes.Cardiomyopeptidin 50 mg/L did not change the steady state activation curve of I_(to).Conclusions Cardiomyopeptidin decreases the I_(to) of rat ventricular myocytes,which might be one of the mechanisms of its antiarrhythmic effect.