Objective To study the effect of ketamine on L-type calcium currents (ICa-L) in guinea pig ventricular myocytes. Methods Adult guinea pigs of both sexes were anesthetized with pentobarbital. The hearts were immediately removed and ventricular myocytes were prepared by the technique described by Liu et al. The whole-cell patch clamp technique was used to study the ICa-L in isolated guinea pig ventricular myocytes. The changes in ICa-L produced by ketamine 100 ?mol?L-1 with different holding potentials or by different concentrations of ketamine with holding potential of + 10 mV were analyzed. Results Ketamine dose-dependently inhibited ICa-L evoked by a voltage step from a holding potential of - 40 mV to + 10 mV. The 4 concentrations of ketamine (100, 500, 1 000, 5 000 ?mol?L-1) reduced 1Ca-L by 28.7%?5.7% , 34.7%?1.4%, 58.7%?6.4% and 81.7%?6.7% respectively, with a mean IC50 concentration of 926.6 ?mol?L-1 . When the cells were exposed to ketamine 100 ?mol?L-1, the steady-state activation curve was not significantly affected, while the steady-state inactivation curve was shifted to more negative potentials.V1/2 decreased from ( - 14.8?0.8 ) mV to ( - 19.6?0.7) mV (P0.05) in control and drug-affected cells respectively. Ketamine slowed the rate of recovery from inactivation. Conclusion Ketamine can inhibit ICa-L in guinea pig ventricular myocytes in a concentration-dependent manner. This inhibitory effect of ketamine may explain its negative inotropic effect. Ketamine inhibits L-type calcium channel in its inactivated state.

BACKGROUND:Various surface modification techniques have been used to improve the bioactivity of titaniumimplant in vivo. OBJECTIVE:To investigate the effects of enamel matrix proteins (EMPs) on the growth of apatite coatings on dual thermo-etching treated pure titanium. METHODS:EMPs were extracted from porcine tooth germs and then were identified. Dual thermo-etching was applied to treat titanium samples fol owing polished, and then immersed in a blank simulated body fluid supersaturated calcification solution (control group) or supersaturated calcification solution containing different concentrations of EMPs for 7 days. The morphology of samples was observed using scanning electron microscope, and element components and crystal structures of the apatite coatings were analyzed by energy dispersive spectrometer and X-ray diffraction. RESULTS AND METHODS:After double-etching, a pit-like rough surface was observed on the titanium plate. After 7-day mineralization, in the control group, no overt calcium-phosphate deposits were found on the titanium surface;however, in the experimental groups, there were calcium-phosphate deposits, whose quantity and morphology changed with increasing concentrations. Energy dispersive spectrometer showed that the main element components of the mineralized coating included calcium, phosphorus, oxygen and carbon, and the calcium-phosphate ratio ranged from 1.32 to 1.41. The apatite coatings were proved to be carbonate hydroxyapatite by X-ray diffraction. To conclude, EMPs promote apatited deposition on pure titanium surfaces in a concentration-dependent manner.

0 05).Among the 13 patients with liver damage,AKP and ? GT were raised in 6,and AKP,? GT,TBIL and DBIL all elevated in 4 In 8 patients anti SMA and AMA were detected,and 5 showed AMA positive.Liver biopsy in 6 patients showed 3 with chronic active hepatitis among which 2 were complicated with liver cirrhosis,1 chronic persistent hepatitis and 2 cholangitis.Of the 6 patients 5 showed different degrees of infiltration of mononuclear cells in the portal tracts.Conclusion The occurrence of liver damage in pSS is rather high.The liver damage may be related to primary biliary cirrhosis (PBC).Patients′ response to corticosteroid treatment is favourable and their prognosis appears good.

0 05).Conclusion The standards of Amor and ESSG have higher sensitivity and specificity to diagnose spondyloarthropathy in China.The two standards have no difference in statistics.

OBJECTIVETo explore the clinical effects of minor bone anchors and palmaris longus tendon graft in treating chronic mallet fingers deformity.

METHODSFrom January 2008 to June 2013, 26 patients with chronic mallet fingers deformity were treated with minor bone anchors and palmaris longus tendon graft. There were 18 males and 8 females, aged from 18 to 52 years old with an average of (32.0±1.3) years. Among them, 8 cases caused by machine injury, 6 cases by fall injury, 6 cases by sprain from fight, 4 cases by tendon spontaneous rupture, 2 cases by knife trauma. There was no tendon attachment of extensor tendon check in 16 cases, and with 0.3 to 0.5 cm tendon attachment in 10 cases. All patients had the flexion deformity and the disability of dorsiflexion activity. During operation, the distal interphalangeal joint was fixed in 10° to 20° dorsiflexion by a Kirshner wire, the minor bone anchor was used to reconstruct the extensor tendon insertion, the palmaris longus tendon slice was transplanted the decayed area of extensor tendon insertion. Four weeks postoperatively, the Kirshner wire was removed and the plaster external fixation was used, and the patient began function exercises. Postoperative complications were observed and fingers functions were assessed according to Dargan standard.

RESULTSThe patients were followed up from 6 to 14 months with an average of (5.0±0.3) months. Wound superficial infection occurred in 2 cases, the skin pressure ulcer in 2 cases, joint activities disability in 1 case; these symptoms got improvement after symptomatic treatment. Traumatic arthritis occurred in 2 cases, 1 case was improved after treatment, and 1 case had chronic pain for a long time. No internal fixation loosening or breakage and tendon rupture were found. According to Dargan standard to evaluate the finger function, 17 cases got excellent results, 8 good, and 1 poor.

CONCLUSIONIt is an effective way to treat the chronic mallet finger deformity using minor bone anchors and palmaris longus tendon graft, and the method has advantages of reliable fixation, easy operation, satisfactory effect and less complication.

Adolescent ; Adult ; Female ; Finger Injuries ; surgery ; Fracture Fixation, Internal ; Hand Deformities, Acquired ; surgery ; Humans ; Male ; Middle Aged ; Suture Anchors ; Tendon Transfer

BACKGROUND:The majority of published article on cardiopulmonary resuscitation (CPR) used healthy animals. In fact, patients commonly have severe heart diseases before CPR, leading to ventricular fibrillation. OBJECTIVE: To investigate outcome of myocardial function and cardiopulmonary resuscitation in myocardial infarction rats treated with bone marrow mesenchymal stem cells (MSCs) transplantation.DESIGN, TIME AND SETTING: A randomized, controlled animal experiment was performed at the University of Southern California and Second Hospital of Sun Yat-sen University from April to August 2007.MATERIALS: A total of 18 adult male SD rats were randomly divided into model control and cell transplantation groups with 9 animals in each group. In addition, 1 SD rat aged 1 month was used to prepare bone marrow MSCs.METHODS: Myocardial ischemia was induced by ligation of the left anterior descending artery (LAD). Animals respectively received 5×106 MSCs (0.1 mL) marked with PKH26 in phosphate buffer solution (PBS) or PBS alone 4 weeks after LAD ligation. Ventricular fibrillation and CPR were performed 4 weeks after MSCs or PBS injection.MAIN OUTCOME MEASURES: Heart function was evaluated by ultrasound cardiography 2, 4 weeks after transplantation; hemodynamics was measured before and 4 hours following CPR. Myocardial tissues were harvested 72 hours after CPR for pathological exanimation.RESULTS: Compared with model control group, ejection fraction of transplantation group was significantly increased 2 and 4 weeks after transplantation (P<0.01), and cardiac index, dp/dt40, and -dp/dt were significantly improved before and within 4 hours after CPR (P<0.01, P<0.05). Moreover, the rats survived longer in transplantation group (72 hours) after CPR compared with control group (P<0.05). Pathological section results showed a large number of PKH26-1abeled MSCs in the rnyocardium.CONCLUSION: Myocardial function, hemodynamics and survival time after CPR were significantly improved in animals treated with MSCs transplantation.

Objectives To investigate the clinical and pathological characters , treatment of patients with Angioimmunoblastic T cell lymphoma(AITL). Methods From 1997 to 2004, 14 patients with AITL were reviewed retrospectively in our hospital. Results The most common symptoms at the presentation included general lymphadenopathy. 9 patients had fever. 3 patients had autoimmune hemolytic anemia.The histopathologic characteristics of AITL was generalized as:the damage of normal structure of lymphonodus,the proliferation of immunoblastic cell and arborescent supervascularization. All immunophenotyping were T cell type.14 patients were with ProMACE-CytaBOM regimen.The overall response rate was 57% and CR 3 cases, PR 5 cases. Median survival times was 25 months. 2-year survival was 60 %. Conclusions The most cases with AITL runs an aggressive course.The disease may progress rapidly and have unfavorable prognosis. Therefore further studies are repuired to improve the outcome.

AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.

OBLECTIVE:To promote a sustained and quick development of the high-tech medicine industry in our country.METHODS:The related literature was consulted and the current developmental status of the high-tech medicine in-dustry in our country was analyzed.RESULTS&CONCLUSIONS:The high-tech industry in our country can be pushed on only through rearrange industry mix at the right time,constructing a serial comprehensive development terrace,supporting es-pecially those medicine enterprises that with core technology and independent intellectual property rights,building a virtual strategic league together with the academy of higher learning and scientific research institutes.

Objective To use autologous costicartilage trestle to correct secondary cleft lip nasal deformity,in order to obtain a nice nose.Methods A total of 64 patients were treated,including 51 unilateral and 13 bilateral cleft lip,aged 16 to 38 years,with the average of 21 years.The deformity included cripetura columellar,flattened nasal tip,anisopleural nostril and caved nosewing.The carven costicartilage was embedded into bilateral nasal septum to form a new trestle for remodelling the shape of nose and nasal tip.Results The follow-up time was 3 months to 2 years,showing that all patients were satisfied with the outline of external nose,without infection and costicartilage revealed.Conclusions The autologous costicartilage is easy to collect without rejection reaction,and therefore it can be used in correcting secondary cleft lip nasal deformity with fair improvement of nasal outline,especially in nasal tip height.