BACKGROUND:Various surface modification techniques have been used to improve the bioactivity of titaniumimplant in vivo. OBJECTIVE:To investigate the effects of enamel matrix proteins (EMPs) on the growth of apatite coatings on dual thermo-etching treated pure titanium. METHODS:EMPs were extracted from porcine tooth germs and then were identified. Dual thermo-etching was applied to treat titanium samples fol owing polished, and then immersed in a blank simulated body fluid supersaturated calcification solution (control group) or supersaturated calcification solution containing different concentrations of EMPs for 7 days. The morphology of samples was observed using scanning electron microscope, and element components and crystal structures of the apatite coatings were analyzed by energy dispersive spectrometer and X-ray diffraction. RESULTS AND METHODS:After double-etching, a pit-like rough surface was observed on the titanium plate. After 7-day mineralization, in the control group, no overt calcium-phosphate deposits were found on the titanium surface;however, in the experimental groups, there were calcium-phosphate deposits, whose quantity and morphology changed with increasing concentrations. Energy dispersive spectrometer showed that the main element components of the mineralized coating included calcium, phosphorus, oxygen and carbon, and the calcium-phosphate ratio ranged from 1.32 to 1.41. The apatite coatings were proved to be carbonate hydroxyapatite by X-ray diffraction. To conclude, EMPs promote apatited deposition on pure titanium surfaces in a concentration-dependent manner.

Objective To study the effect of ketamine on L-type calcium currents (ICa-L) in guinea pig ventricular myocytes. Methods Adult guinea pigs of both sexes were anesthetized with pentobarbital. The hearts were immediately removed and ventricular myocytes were prepared by the technique described by Liu et al. The whole-cell patch clamp technique was used to study the ICa-L in isolated guinea pig ventricular myocytes. The changes in ICa-L produced by ketamine 100 ?mol?L-1 with different holding potentials or by different concentrations of ketamine with holding potential of + 10 mV were analyzed. Results Ketamine dose-dependently inhibited ICa-L evoked by a voltage step from a holding potential of - 40 mV to + 10 mV. The 4 concentrations of ketamine (100, 500, 1 000, 5 000 ?mol?L-1) reduced 1Ca-L by 28.7%?5.7% , 34.7%?1.4%, 58.7%?6.4% and 81.7%?6.7% respectively, with a mean IC50 concentration of 926.6 ?mol?L-1 . When the cells were exposed to ketamine 100 ?mol?L-1, the steady-state activation curve was not significantly affected, while the steady-state inactivation curve was shifted to more negative potentials.V1/2 decreased from ( - 14.8?0.8 ) mV to ( - 19.6?0.7) mV (P0.05) in control and drug-affected cells respectively. Ketamine slowed the rate of recovery from inactivation. Conclusion Ketamine can inhibit ICa-L in guinea pig ventricular myocytes in a concentration-dependent manner. This inhibitory effect of ketamine may explain its negative inotropic effect. Ketamine inhibits L-type calcium channel in its inactivated state.

0 05).Among the 13 patients with liver damage,AKP and ? GT were raised in 6,and AKP,? GT,TBIL and DBIL all elevated in 4 In 8 patients anti SMA and AMA were detected,and 5 showed AMA positive.Liver biopsy in 6 patients showed 3 with chronic active hepatitis among which 2 were complicated with liver cirrhosis,1 chronic persistent hepatitis and 2 cholangitis.Of the 6 patients 5 showed different degrees of infiltration of mononuclear cells in the portal tracts.Conclusion The occurrence of liver damage in pSS is rather high.The liver damage may be related to primary biliary cirrhosis (PBC).Patients′ response to corticosteroid treatment is favourable and their prognosis appears good.

0 05).Conclusion The standards of Amor and ESSG have higher sensitivity and specificity to diagnose spondyloarthropathy in China.The two standards have no difference in statistics.

Objective:To examine the adiponectin level in gingival crevicular fluid(GCF)in patients of chronic periodontitis with dia-betes mellitus type 2.Methods:20 patients of diabetes mellitus type 2 with chronic periodontitis(DM&CP),20 of periodontitis(CP) and 20 health subjects(H)were included.The periodontal indexes (SBI,PLI,PD and AL)were measured,GCF samples were quan-tified by periotron 8000,the adiponectin content in GCF was tested by adiponectin ELISA kit.The relationship between the adiponectin level in GCF and the periodontal indexes of the DM&CP patients was analyzed statistically.Results:The adiponectin level in GCF in group DM&CP was significantly lower than that in the other 2 groups(P <0.05).The adiponectin levels in GCF in group CP and H were not statistically different.The adiponectin level in GCF was negatively correlated with PD and AL(P <0.05),but had no correlation with SBI and PLI(P >0.05).Conclusion:Decrease of adiponectin in GCF may play a role in the development of DM&CP.

Background and purpose:The gastric cancer is the highest incidence of malignant tumors in the world. The main treatment methods for gastric cancer are operation and chemotherapy. But the effect is not good. With the rapid development of economy and molecular biology, early diagnosis and molecular targeted therapy for gastric cancer has become a research hotspot. The oncogene overexpression and the anti-oncogene lower expression are closely related with gastric cancer.CDC4/FBXW7 is an anti-oncogene, butc-Myc is an oncogene. The previous research showed that CDC4 affected the expression of many oncogenes, such as Cyclin E. This study aimed to investigate the expression of CDC4 and c-Myc in gastric cancer and to elucidate the potential relationship between their expressions and clinical pathological characteristics.Methods:Semi-quantitative reverse transcription polymerase chain reaction (sRT-PCR), immunohistochemistry and Western blot method were used to determine the mRNA and protein expressions of CDC4 and c-Myc in 40 specimens of gastric carcinoma tissues, corresponding adjacent tissues and normal mucosal tissues. The expressions of CDC4 and c-Myc and the clinical pathological characteristics were analyzed.Results:The protein expressions of CDC4 in gastric cancer tissues were signiifcantly lower than those in adjacent tissues and normal mucosal tissues (P<0.05), whereas the protein expression of c-Myc in gastric cancer tissues was signiifcantly higher than that in adjacent tissues and normal mucosal tissues (P<0.05). The protein and mRNA expression of CDC4 and c-Myc were correlated with differentiation, TNM stage, lymph node metastasis, inifltration, but not with patients’ gender, age and site of cancer (P<0.05). There was a signiifcant negative correlation between CDC4 and c-Myc at the mRNA and protein expression levels (P<0.05).Conclusion:The lower expression of CDC4 is correlated with differentiation, TNM stage, lymph node metastasis and inifltration. c-Myc overexpression is likely to be the CDC4 loss. It suggests that the loss of CDC4 may be a valuable marker for assessing the diagnosis and treatment and the prognosis of gastric cancer.

Objective To investigate the clinical treatment of nonpenetrated cornea trauma caused by crops. Methods Clinical data of 128 cases of nonpenetrated cornea trauma caused by crops were retrospectively analyzed. According to the interval time between occurrence of trauma and clinic visiting, the patients were divided into 3 groups:group A (33 cases,<24 h), group B (72 cases, 24 h≤interval time<1 week) and group C (23 cases, ≥ 1 week). The therapeutic effects and prognosis were analyzed. Results There was statistical difference in the incidence of corneal ulcer among group A, group B and group C: 6.1% (2/33), 62.5% (45/72) and 100.0% (23/23), χ2= 52.32, P<0.01. In group B, 12 cases were treated with conjunctival flap covering, 2 cases received keratoplasty and 2 cases undertook enucleation. In group C, 10 cases were treated with conjunctival flap covering, 4 cases received keratoplasty and 2 patients undertook enucleation finally. All the other patients were cured with local debridement and medical treatment. Conclusions Patients with nonpenetrated cornea trauma caused by crops may develop infectious keratitis, and prompt and proper treatment can avoid the secondary infection and improve the outcome. Local debridement in combination with iodophors disinfection can prevent the incidence of infectious keratitis. Conjunctival flap covering is an effective technique in the treatment of corneal ulcer caused by nonpenetrated cornea trauma.

To investigate the prevalence and gene types of KPC in Enterobacteriaceae strains isolated from 4 tertiary general hospitals in Hainan area ,a total 43 isolates which were resistant or intermediate to imipenem or ertapenem were collected from sterile sites between August 2012 and June 2013 from 4 tertiary general hospitals in Hainan area .Modified Hodge Tests (M HT ) were performed for KPC phenotype screening .PCR amplification and DNA sequence were performed to analyze the encoding genes of KPC .Results showed that in the 43 isolates ,21 strains were positive in M HT .PCR and DNA sequence analysis confirmed that 3 isolates produced KPC‐2 .It's suggested that there were the Enterobacteriaceae carrying KPC in Hain‐an area .The encoding genes were KPC‐2 .The KPC gene could be horizontally transmitted by plasmid among different groups of bacteria .It is important to control the transmission of these Enterobacteriaceae carrying KPC .

AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.

OBLECTIVE:To promote a sustained and quick development of the high-tech medicine industry in our country.METHODS:The related literature was consulted and the current developmental status of the high-tech medicine in-dustry in our country was analyzed.RESULTS&CONCLUSIONS:The high-tech industry in our country can be pushed on only through rearrange industry mix at the right time,constructing a serial comprehensive development terrace,supporting es-pecially those medicine enterprises that with core technology and independent intellectual property rights,building a virtual strategic league together with the academy of higher learning and scientific research institutes.