To determine the effects of Remifentanil on the expression of adhesive factors during acute lung injury, we used immunohistochemistry and reverse transcription polymerase chain reaction (RT PCR) technics to measure the expression levels of ICAM 1, and P Selectin in the lung in a rat model of hemorrhagic shock. We duplicated modified Wigger hemorrhagic shock model in healthy SD rats. The rats were divided into three groups: control group, resuscitation group, resuscitation and drug using group. The positive ratios of ICAM 1 and P Selectin in the lungs at different time points, namely preshock, shock, resuscitation 2 hours, and resuscitation 4 hours were determined. There were 6 rats in each group and each time point. The degree of pulmonary injury in the drug using group was less than that in other two groups. Resuscitation with lactated Ringer's solution led to most serious injury in the resuscitation group. In drug using group, the expression of ICAM 1 and P Selectin was far less than that in the other two groups ( P

Objective To determine the modulating effects of remifentanil on the expression of apoptosis factors during acute lung injury as a result of hemorrhagic shock, we observed the expression of C-Jun, Bax, Bcl-2 in lung with immunohistochemistry in rats with hemorrhagic shock. Methods Hemorrhagic shock model was replicated with modified Wigger's method in healthy SD rats. Seventy-two rats were randomized into three groups: sham resuscitation, resuscitation with lactated Ringer′s solution, and fluid resuscitation with remifentanil. Positive rates of C-Jun, Bax, Bcl-2 were assayed in the lungs at different time points: preshock, shock, 2 hours after resuscitation, and 4 hours after resuscitation. Results ①The model of acute lung injury subsequent to hemorrhagic shock was reproduced in rats. ②The expression of Bcl-2 elevated slowly in three groups, while the expression of Bax elevated rapidly, and there were significant differences between the value of baseline and those of other time points (P

Angiography, Digital Subtraction ; Embolization, Therapeutic ; Humans ; Retroperitoneal Neoplasms ; diagnosis ; surgery ; therapy ; Stents ; Vascular Surgical Procedures ; methods

Objective: To study the expression of heparanase and CD44v6 in osteosarcoma and analyze the correlation between them. Methods: The expressions of heparanase and CD44v6 in human osteosarcoma were detected by immunohistochemical staining. Results: The positive rates of heparanase and CD44v6 protein in osteosarcoma tissues were significantly higher in osteosarcoma tissues than in osteochondroma (79.6% vs 20.0% and 55.1% vs 25.0%, P < O. 05). Expressions of heparanase and CD44v6 had positive correlation (r=0.663, P < 0.001). Both of them were closely associated with clinical stage and metastasis of osteosarcoma. Conclusion: Overexpressions of heparanase and CD44v6 in human osteosarcoma may stimulate the adhesion, invasion, and metastasis of osteosarcoma.

Objective: To screen the optimal formula and preparation process of vitamin B1 ( VB1 ) sustained-release tablets. Methods:The single-factor tests were used to investigate the type of filler, type and amount of matrix material hydroxypropyl methycel-lulose(HPMC), type and amount of retarder, tablet weight and core hardness. The orthogonal tests were used to investigate the amount of HPMC and ethyl cellulose( EC) and the core hardness. Results:The optimum formula was as follows:HPMC accounted for 50% of the tablet weight, EC accounted for 20%, the filler was lactose, the tablet weight was 200 mg and the tablet core hardness was 50 N. Conclusion:The prepared sustained-release tablets have significant controlled-release property, which provides reference for the devel-opment of new dosage form for VB1 .

Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.

Background Diabetes mellitus (DM) can provoke the apoptosis of retinal cells and downregulate the expression of calcitonin gene related peptide (CGRP) in the retina.Capsaicin promotes the release of CGRP and elicits protective effects on human organs.However,whether CGRP protects retinal cells in diabetic retinopathy (DR) is still unclear.Objective The study was designed to examine the effect of capsaicin on the apoptosis of retinal cells in diabetic rats and its relationship with CGRP.Methods Forty clean healthy adult male Sprague-Dawey rats were randomly divided into the diabetes group,capsaicin pretreated group,streptozocin (STZ)control group,capsaicin control group and plain control group,with 8 rats per group.The diabetic model was established by the intraperitoneal injection of 60 mg/kg in all rats except those of the plain control group.0.4 mL of a 1％ capsaicin injected at 20 mg/kg was subcutaneously injected for 3 consecutive days prior to model establishment in the capsaicin pretreated group,after which 1.2 mL of STZ was intraperitoneally injected on the fourth day.Rats from the STZ control group were administered intraperitoneally 1.2 mL of 0.1 mol/L,pH 4.5,citrate buffer.The capsaicin control group received subcutaneous injections of 0.4 mL of 1％ capsaicin at 20 mg/kg for 3 consecutive days,after which 1.2 mL of 0.1 mol/L,pH 4.5,citrate buffer was administered intraperitoneally.The rats were sacrificed at the tenth week after model establishment and retinal specimens were prepared for the apoptosis assay by TUNEL staining and the quantitative analysis of caspase-3 activity.Expression of CGRP in the retina and serum was detected using ELISA.The use of experimental animals followed the Regulations for the Administration of Affairs Concerning Experimental Animals by State Science and Technology Commission.Results Retinal cell apoptosis was mainly localized to the retinal ganglion cell (RGC) layer.The apoptosis rate of RGCs was (43.4±5.0)％ in the DR model group and (30.0±5.1)％ in the capsaicin pretreated group,showing a significant difference (t =5.930,P＜0.01).Compared with the DR model group and capsaicin pretreated group,the apoptosis rates of the DR control group (12.4±9.9) ％ and the capsaicin control group (17.6-±6.1) ％ were significantly lower (t =8.800,t =4.925,P＜0.01).The apoptosis rate of the plain control group was (16.2±6.9)％,exhibiting significant differences in comparison with the DR control group and capsaicin control group (t =-0.989,t =0.951,P＞0.05).The specific activity of caspase-3 was (2.19±0.86) in the DR model group and (1.96±0.56) in the capsaicin pretreated group,presenting a significant difference (t =-0.515,P＜0.05).Those of the DR control group and capsaicin control group were (1.47±0.14) and (0.74±0.27),respectively,with considerable decline in comparison with the DR model group and capsaicin pretreated group (t=2.142,t=2.797,P＜0.05).The retinal and serum CGRP levels were (424.4±44.2)and (148.8±39.1) ng/L,respectively,displaying significantly lower levels than (543.2±74.4) and (237.5±78.7) ng/L (t =3.070,2.359,P＜0.05) from the capsaicin pretreated group.Conclusions Apoptosis of retinal ganglion cells occurs in the STZ-induced diabetic rats.Pretreatment of capsaicin reduces retinal cell apoptosis,which may be associated with an increase of CGRP in the retina.

Background Perineural invasion is an important biological character for adenoid cystic carcinoma (ACC) of lacrimal gland,which is different from those of other lacrimal gland tumors.As the important part of neurotrophic factors,glial-derived neurotrophic factor (GDNF) plays an important role in perineural invasion for ACC of salivary gland.GDNF regulation in the ACC cell biology function needs to be further explored.Objective This study was to investigate the effect of GDNF on proliferation and migration of ACC cells,and to explore the mechanism of neural invasion in ACC of lacrimal gland.Methods ACC-2 cell line was cultured and passaged in RPMI 1640 medium with 10％ fetal bovine serum,100 U/ml penicillin and 0.1 g/L streptomycin.Single-cell suspension was prepared with the density of 2×104/ml using logarithmic phase of cells and then incubated to 96-well plate.GDNF with the final concentration of 20,60,80,100 and 120 μg/L was added into the medium respectively in the experimental groups,and the cells were cultured in the medium without GDNF as the control group.The expression of GDNF in ACC-2 cells was detected by immunohistochemistry.MTT assay was employed to assay the absorbance value at the wavelength of 570 nm (A570) for the evaluation of proliferation of ACC-2 cells after cultured by different concentrations of GDNF for different time points.Meanwhile,transwell chamber was used to examine the cell migrated number.Results Immunochemistry assay exhibited that ACC-2 cells showed the positive response for GDNF with the brown staining in the cytoplasm.In 48 hours after culture,the A570 value was elevated with the increase of GDNF concentration,showing a significant difference among various groups (F =3.336,P =0.026),and the A570 value in various concentrations of GDNF groups was higher than that of 0 μg/L GDNF group (all P＜0.05).After action of 80 μg/L GDNF,the A570 value of the cells was gradually increased with the prolong of culture time (Ftime =39.979,P=0.000).In 30 minutes after GDNF cultured,the number of migrated cells increased with the increase of GDNF concentration (F=144.886,P=0.000).ACC-2 cells were cultured by 100 μg/L GDNF for 24,30 and 40 hours,the number of migrated cells were more as the time lapse,and more migrated cells were seen in GDNF group at various time points (Ftime =46.747,P =0.000 ; Fgroup =63.786,P =0.000).Conclusions GDNF can stimulate the proliferation and migration of ACC-2 cells in a dose-and time-dependent manner.

Objective To evaluate the efficacy and safety of linezolid in the treatment of gram-positive coccus in-fection in the elderly.Methods Clinical data of patients (>60 years old)infected with gram-positive coccus and treated with linezolid for 10 days between January 2013 and December 2014 were collected,the therapeutic efficacy of linezolid were analyzed,laboratory indexes before and 14 days after linezolid treatment were compared,possible adverse effects were analyzed.Results A total of 70 old patients were enrolled,the majority of patients were infec-ted in lower respiratory tract (62.86%)and were infected with Staphylococcus aureus (42.86%,of which 19 were MRSA),more than 80% of the patients were >70 years old,had length of stay > 30 days,and admitted in ICU, more than 70% of the patients were with deep venous catheterization and indwelling urinary catheterization.Platelet count (PLT)after 14 days of linezolid treatment was significantly lower than before treatment([132.00±45.00]× 109/L vs [156.00±78.00]×109/L,P =0.009);the total therapeutic efficacy of linezolid was 81 .43%(57/70), while the rate of adverse effects was 17.14% (12/70).Conclusion Linezolid is effective for treatment of gram-posi-tive coccus infection in the elderly,and may be a good choice of empirical treatment.PLT should be intensively mo-nitored during the process of linezolid therapy.

China ; Cleft Lip ; etiology ; therapy ; Cleft Palate ; etiology ; therapy ; Humans