Objective: To perform a bibliometric analysis of papers published by Second Military Medical University in journals covered by Science Citation Index (expanded) (SCIE) during 1994-2009, so as to provide evidence for decision making in scientific research adminstration. Methods: The papers published in journals covered by SCIE authored by researchers of Second Military Medical University in 1994-2009 were retrieved and analyzed; the impact factor (IF) of 2008 published by Institute for Scientific Information(ISI)was used in the present study. Results: A total of 3,539 papers were retrieved from 926 journals. Original article accounted for 83% of the total; those with an IF lower than 5 accounted for 77% and those with an IF higher than 10 accounted for 3.3%. There were 206 papers which had been cited for more than 20 times; the most active subject was immunology; and the closest cooperation in publication was with Shanghai Jiaotong University. Conclusion: This study introduces the publication of scientific papers published by Second Military Medical University and their citations from a bibliometric perspective, which provides a quantitative reference for the scientific administration department and the researchers.

Objective To supervise the execution process of medical orders,prevent and avoid malpraxis,improve the security of the nursing action.Methods On the demand of preventing and reducing malpraxis,the system structure and software design were implemented based on RFID and wireless technology.Results The functions of real-time examining and affirming were achieved in every step of medical orders,including unique identification for the patient identification,medicine and blood bag,etc.Conclusion The system can be ensured the security of patients,improved the quality of medical care,reduced the malpraxises and made great contribution for medical care.

Objective To investigate the relationship between intraoperative cerebral oxygen saturation (rSO2) and postoperative cognitive dysfunction with near-infrared cerebral oximeter (INVOS 5100) in patients operated under inhalational combined intravenous anesthesia, and to determine the critical rSO2 value below which postoperative cognitive dysfunction may occur. Methods Sixty ASAⅠ-Ⅱ patients of both sexes were selected, aged 62-80yr, weighed 58-77kg, scheduled for elective abdominal surgery or surgery on the low limb. All the patients were divided into three groups according to their educational background: in group Ⅰ were the illiterate and uneducated patients (n=20);group Ⅱ the primarily educated patients (<6yr education) (n=20), and group Ⅱ the well educated patients (>6yr education) (n=20). Each group was further divided into isoflurane and sevoflurane subgroups (n=10 in each subgroup). All patients received no pre-medication. Anesthesia was induced with intravenous atropine 0.3mg, propofol 1.0-1.5mg kg-1, fentanyl 2-3μg*kg-1 and vecuronium 0.1-0.2mg*kg-1, and maintained with isoflurane or sevoflurane inhalation(0.9-1.1 MAC) supplemented with intermittent i.v. boluses of fentanyl, and recorded after entering room (baseline) (T0), after O2 inhalation (T1), after induction of anesthesia (T2), after skin incision (T3), during operation (T4), the end of surgery (T5), and awaking (T6). Mini-Mental State Examination (MMSE) was performed before anesthesia and 1, 4, 8, 12 and 24h after surgery. BP, HR, ECG, SpO2, PETCO2 and end-tidal concentration of inhalational anesthetics were continuously monitored during anesthesia. Results In all three groups rSO2 was significantly lower during operation (T4) and at the end of surgery (T5) than baseline (T0) (P<0.05). In all patients the MMSE scores at 1h after operation were significantly lower than the baseline value (P<0.05). The MMES scores in all patients significantly declined within 1-4h after surgery, and the cognitive function recovered at 4h after surgery in 85% patients. The critical values of rSO2 below which postoperative cognition dysfunction may occur were: 45 (group Ⅰ), 47 (group Ⅱ) and 49 (group Ⅲ) for isoflurane anesthesia subgroups;47 (group Ⅰ), 48 (group Ⅱ) and 50 (group Ⅲ) for sevoflurane subgroups. Conclusion The perioperative rSO2 should be maintained up to above 50% to reduce the incidence of postoperative cognitive dysfunction under inhalational combined intravenous anesthesia.

Objective To investigate the effects of propofol sedation on different areas of cerebral cortex and memory during operation performed under epidural anesthesia using EEG non-linear monitor and determine the critical value of approximate entropy, the EEG non-linear parameter, without implicit memory.Methods Ten ASA I or II patients of both sexes aged 42-56 yr weighing 59-73 kg undergoing elective abdominal or lower limb operation under epidural anesthesia were enrolled in the study. The patients were unpremedicated. After correct placement of epidural catheter was confirmed, a mixture of 2% lidocaine and 0.3% tetracaine 13-15 ml was injected via the catheter. Propofol was then infused i.v. at 6 mg?kg-1?h-1 for sedation. BP, HR and SpO2 were continuously monitored. The EEG non-linear monitor (ZN16E) was used. The sensors were placed on frontal (FP1 , FP2 ) , temporal (T3 , T4 ), parietal (C3 , C4 ) and occipital ( O1 , O2 ) regions. Approximate entropy and topographic map of approximate entropy were recorded before and during propofol infusion. Sedation scores (OAA/S, 1 = deep sleep, 5 = alert) were assessed during operation The patients' explicit and implicit memory scores were estimated by Process Dissociation Procedure during anesthesia sedateon Results The approximate entropy was significantly decreased during propofol sedation compared to the baseline value before sedation. OAA/S score were maintained at 1 during operation. The explicit and implicit memory scores were significantly decreased during propofol sedation compared to the baseline scores before anesthesia sedation( P

Objective To investigate the changes of lithium metabolic balance in normal controls and in patients with type-two diabetes mellitus.Method Lithium was measured by atomic absorbent spectrometry.Results (2 91?0 54)?mol/d of lithium intake (2 37?0 51)?mol/d in urine and (0 28?0 05)?mol/d in stool,(0 27?0 24)?mol/d of lithium equilibrium value(LEV),(2 64?0 51)?mol/d of intestinal lithium absorption value(ILAV),(90 4?18)% of intestinal lithium absorption rate(ILAR) and (81 0?1 5)% of ratio of urine lithium excretion to lithium intake(ULE/LI)in normal controls;as well as (2 24?0 25)?mol/d of lithium in food,(2 15?0 36)?mol/d in urine,(0 35?0 05)?mol/d in stool,(-0 25?0 06)?mol/d of LEV,(1 89?0 33)?mol/d of ILAV,(84 3?2 1)% of ILAR and (95 6?3 2)% RU/I in diabetic patients respectively.Lithium in food and stool,LEV,ILAV and ILAR in diabetes were lower than those in controls (P

Objective To study the effect of inhalational anesthetics on brain cortices under inhalational and intravenous combined anesthesia. Methods 45 patients were randomly divided into isoflurane group (n=15), sevoflurane group (n=15) and desoflurane group (n=15). The narcosis was maintained with inhalational and intravenous combined anesthesia. The EEG non-linear parameters including approximate entropy (ApEn) and correlation dimension (D 2 ) were recorded during operation periods. BP, HR, and SpO 2 were monitored routinely. Results Comparing with that at entrance to the operating room, the EEG activities of frontal and temporal cortices after anesthesia were more suppressed than other cortices. Comparing with that at entrance to the operating room, ApEn and D 2 were significantly declined in the three experimental groups (P

Objective To study effect of propofol on different areas of brain cortex under total intravenous propofol and fentanyl anesthesia. Methods 20 patients were randomly divided into propofol 8mg/(kg?h) group (n=10) and 10mg/(kg?h) group (n=10). The anesthesia was maintained by total intravenous propofol and fentanyl anesthesia. The EEG non-linear parameters, i.e. approximate entropy (ApEn)and correlation dimension (D 2), were recorded during perioperative periods. BP, HR, SpO 2 were monitored routinely. Results Compared with that at entry of OR, the EEG activities of frontal, parietal, and temporal cortices after anesthesia were more inhibited than that of other areas in both groups. Also EEG non-linear parameters were lower significantly after anesthesia in both groups compared with those at entry of OR (P

Objective To analyze the bispectral index (BIS) and the EEG nonlinear index (including Correlation dimension, D2; Approximate entropy, ApEn; Complexity, Cx.) during alternating periods of consciousness and unconsciousness produced by target-controlled infusions (TCI) of propofol. Methods We studied twenty patients (ASA Ⅰ～Ⅱ grades) undergoing the elected leg operations under epidural anesthesia. With TCI consciousness of the patient was controlled by an increase or decrease of concentration of propofol in a range of 0.3～0.5?g/ml for four times. Every target plasma concentration of propofol lasted 12 minutes. BIS, D2, ApEn and Cx were recorded simultaneously during the periods of consciousness and unconsciousness every 3 minutes. Results During consciousness and unconsciousness, the respective mean values for the four measurements were: BIS, 80.2?6.2 and 67.3?7.9; D2, 3.45?0.18 and 3.01?0.16; ApEn, 0.84?0.05 and 0.71?0.06; Cx, 0.55?0.05 and 0.44?0.05. Determined threshold values with 100% specificity during the state of unconsciousness were: BIS, 51 (sensitivity3.8%); D2, 2.90 (sensitivity 30.3%); ApEn, 0.69 (sensitivity42.3%); Cx, 0.41 (sensitivity 25.5%). Conclusion BIS, D2, ApEn and Cx can all reflect the change in consciousness and unconsciousness produced by TCI of propofol. Our findings suggest that of the four EEG variables, ApEn was best in identifying the transition from unconsciousness to consciousness.

The present study was designed to evaluate the effect of anti intercellular adhesion molecule 1(ICAM 1) monoclonal antibody in a rat model of myocardial ischemia reperfusion injury (I/R). Anaesthetized rats were subjected to total occlusion (45 min) of the left main coronary artery followed by 24 h reperfusion. The area of myocardial necrosis, myocardial function (such as LVSP, +P′max, LVEDP and -P′max) and PMN infiltration were measured. We found that the area of myocardial necrosis in treated rats was smaller than that in control group ( P

Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.