1. Statistics and analysis of papers published by Second Military Medical University in journals covered by Science Citation Index (expanded) in 1994-2009
Academic Journal of Second Military Medical University 2010;31(6):663-666
Objective: To perform a bibliometric analysis of papers published by Second Military Medical University in journals covered by Science Citation Index (expanded) (SCIE) during 1994-2009, so as to provide evidence for decision making in scientific research adminstration. Methods: The papers published in journals covered by SCIE authored by researchers of Second Military Medical University in 1994-2009 were retrieved and analyzed; the impact factor (IF) of 2008 published by Institute for Scientific Information(ISI)was used in the present study. Results: A total of 3,539 papers were retrieved from 926 journals. Original article accounted for 83% of the total; those with an IF lower than 5 accounted for 77% and those with an IF higher than 10 accounted for 3.3%. There were 206 papers which had been cited for more than 20 times; the most active subject was immunology; and the closest cooperation in publication was with Shanghai Jiaotong University. Conclusion: This study introduces the publication of scientific papers published by Second Military Medical University and their citations from a bibliometric perspective, which provides a quantitative reference for the scientific administration department and the researchers.
2.THE CARDIOPROTECTIVE EFFECT OF ANTI ICAM-1 MONOCLONAL ANTIBODY ON MYOCARDIAL ISCHEMIA-REPERFUSION INJURY IN RATS
Hong WU ; Qian SHEN ; Tonghu ZHANG
Medical Journal of Chinese People's Liberation Army 2001;0(08):-
The present study was designed to evaluate the effect of anti intercellular adhesion molecule 1(ICAM 1) monoclonal antibody in a rat model of myocardial ischemia reperfusion injury (I/R). Anaesthetized rats were subjected to total occlusion (45 min) of the left main coronary artery followed by 24 h reperfusion. The area of myocardial necrosis, myocardial function (such as LVSP, +P′max, LVEDP and -P′max) and PMN infiltration were measured. We found that the area of myocardial necrosis in treated rats was smaller than that in control group ( P
3.Effects of propofol sedation on different areas of cerebral cortex and memory in patients during epidural anesthesia
Baosen JIA ; Dongju WU ; Hong ZHANG
Chinese Journal of Anesthesiology 1996;0(08):-
Objective To investigate the effects of propofol sedation on different areas of cerebral cortex and memory during operation performed under epidural anesthesia using EEG non-linear monitor and determine the critical value of approximate entropy, the EEG non-linear parameter, without implicit memory.Methods Ten ASA I or II patients of both sexes aged 42-56 yr weighing 59-73 kg undergoing elective abdominal or lower limb operation under epidural anesthesia were enrolled in the study. The patients were unpremedicated. After correct placement of epidural catheter was confirmed, a mixture of 2% lidocaine and 0.3% tetracaine 13-15 ml was injected via the catheter. Propofol was then infused i.v. at 6 mg?kg-1?h-1 for sedation. BP, HR and SpO2 were continuously monitored. The EEG non-linear monitor (ZN16E) was used. The sensors were placed on frontal (FP1 , FP2 ) , temporal (T3 , T4 ), parietal (C3 , C4 ) and occipital ( O1 , O2 ) regions. Approximate entropy and topographic map of approximate entropy were recorded before and during propofol infusion. Sedation scores (OAA/S, 1 = deep sleep, 5 = alert) were assessed during operation The patients' explicit and implicit memory scores were estimated by Process Dissociation Procedure during anesthesia sedateon Results The approximate entropy was significantly decreased during propofol sedation compared to the baseline value before sedation. OAA/S score were maintained at 1 during operation. The explicit and implicit memory scores were significantly decreased during propofol sedation compared to the baseline scores before anesthesia sedation( P
4.Experimental and Clinical Study on Detection of Medically Important Fungi by PCR with A Universal Fungus-specific Primer System
Hong ZHANG ; Shaoxi WU ; Ningru GUO
Chinese Journal of Dermatology 1994;0(05):-
Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.
5.A Study on Metabolic Balance of Lithium in Normal Controls and Type-two Diabetes Mellitus
Hong ZHANG ; Min HU ; Hanwen WU
Journal of Chinese Physician 2001;0(07):-
Objective To investigate the changes of lithium metabolic balance in normal controls and in patients with type-two diabetes mellitus.Method Lithium was measured by atomic absorbent spectrometry.Results (2 91?0 54)?mol/d of lithium intake (2 37?0 51)?mol/d in urine and (0 28?0 05)?mol/d in stool,(0 27?0 24)?mol/d of lithium equilibrium value(LEV),(2 64?0 51)?mol/d of intestinal lithium absorption value(ILAV),(90 4?18)% of intestinal lithium absorption rate(ILAR) and (81 0?1 5)% of ratio of urine lithium excretion to lithium intake(ULE/LI)in normal controls;as well as (2 24?0 25)?mol/d of lithium in food,(2 15?0 36)?mol/d in urine,(0 35?0 05)?mol/d in stool,(-0 25?0 06)?mol/d of LEV,(1 89?0 33)?mol/d of ILAV,(84 3?2 1)% of ILAR and (95 6?3 2)% RU/I in diabetic patients respectively.Lithium in food and stool,LEV,ILAV and ILAR in diabetes were lower than those in controls (P
6.Analysis of the bispectral index (BIS) and the EEG nonlinear index during the sedation by the target-controlled infusion of propofol
Mingwen OUYANG ; Dongyu WU ; Hong ZHANG
Medical Journal of Chinese People's Liberation Army 1981;0(06):-
Objective To analyze the bispectral index (BIS) and the EEG nonlinear index (including Correlation dimension, D2; Approximate entropy, ApEn; Complexity, Cx.) during alternating periods of consciousness and unconsciousness produced by target-controlled infusions (TCI) of propofol. Methods We studied twenty patients (ASA Ⅰ~Ⅱ grades) undergoing the elected leg operations under epidural anesthesia. With TCI consciousness of the patient was controlled by an increase or decrease of concentration of propofol in a range of 0.3~0.5?g/ml for four times. Every target plasma concentration of propofol lasted 12 minutes. BIS, D2, ApEn and Cx were recorded simultaneously during the periods of consciousness and unconsciousness every 3 minutes. Results During consciousness and unconsciousness, the respective mean values for the four measurements were: BIS, 80.2?6.2 and 67.3?7.9; D2, 3.45?0.18 and 3.01?0.16; ApEn, 0.84?0.05 and 0.71?0.06; Cx, 0.55?0.05 and 0.44?0.05. Determined threshold values with 100% specificity during the state of unconsciousness were: BIS, 51 (sensitivity3.8%); D2, 2.90 (sensitivity 30.3%); ApEn, 0.69 (sensitivity42.3%); Cx, 0.41 (sensitivity 25.5%). Conclusion BIS, D2, ApEn and Cx can all reflect the change in consciousness and unconsciousness produced by TCI of propofol. Our findings suggest that of the four EEG variables, ApEn was best in identifying the transition from unconsciousness to consciousness.
7.Design and Implement of Wireless Nurse Information System Based on RFID
Hong WANG ; Fei WU ; Zhuxi ZHANG
Chinese Medical Equipment Journal 1989;0(02):-
Objective To supervise the execution process of medical orders,prevent and avoid malpraxis,improve the security of the nursing action.Methods On the demand of preventing and reducing malpraxis,the system structure and software design were implemented based on RFID and wireless technology.Results The functions of real-time examining and affirming were achieved in every step of medical orders,including unique identification for the patient identification,medicine and blood bag,etc.Conclusion The system can be ensured the security of patients,improved the quality of medical care,reduced the malpraxises and made great contribution for medical care.
8.Relationship between cerebral oxygen saturation and postoperative cognitive dysfunction in elderly patients under inhalational combined intravenous anesthesia
Baosen JIA ; Dongyu WU ; Hong ZHANG
Medical Journal of Chinese People's Liberation Army 2005;30(9):792-795
Objective To investigate the relationship between intraoperative cerebral oxygen saturation (rSO2) and postoperative cognitive dysfunction with near-infrared cerebral oximeter (INVOS 5100) in patients operated under inhalational combined intravenous anesthesia, and to determine the critical rSO2 value below which postoperative cognitive dysfunction may occur. Methods Sixty ASAⅠ-Ⅱ patients of both sexes were selected, aged 62-80yr, weighed 58-77kg, scheduled for elective abdominal surgery or surgery on the low limb. All the patients were divided into three groups according to their educational background: in group Ⅰ were the illiterate and uneducated patients (n=20);group Ⅱ the primarily educated patients (<6yr education) (n=20), and group Ⅱ the well educated patients (>6yr education) (n=20). Each group was further divided into isoflurane and sevoflurane subgroups (n=10 in each subgroup). All patients received no pre-medication. Anesthesia was induced with intravenous atropine 0.3mg, propofol 1.0-1.5mg kg-1, fentanyl 2-3μg*kg-1 and vecuronium 0.1-0.2mg*kg-1, and maintained with isoflurane or sevoflurane inhalation(0.9-1.1 MAC) supplemented with intermittent i.v. boluses of fentanyl, and recorded after entering room (baseline) (T0), after O2 inhalation (T1), after induction of anesthesia (T2), after skin incision (T3), during operation (T4), the end of surgery (T5), and awaking (T6). Mini-Mental State Examination (MMSE) was performed before anesthesia and 1, 4, 8, 12 and 24h after surgery. BP, HR, ECG, SpO2, PETCO2 and end-tidal concentration of inhalational anesthetics were continuously monitored during anesthesia. Results In all three groups rSO2 was significantly lower during operation (T4) and at the end of surgery (T5) than baseline (T0) (P<0.05). In all patients the MMSE scores at 1h after operation were significantly lower than the baseline value (P<0.05). The MMES scores in all patients significantly declined within 1-4h after surgery, and the cognitive function recovered at 4h after surgery in 85% patients. The critical values of rSO2 below which postoperative cognition dysfunction may occur were: 45 (group Ⅰ), 47 (group Ⅱ) and 49 (group Ⅲ) for isoflurane anesthesia subgroups;47 (group Ⅰ), 48 (group Ⅱ) and 50 (group Ⅲ) for sevoflurane subgroups. Conclusion The perioperative rSO2 should be maintained up to above 50% to reduce the incidence of postoperative cognitive dysfunction under inhalational combined intravenous anesthesia.
9.Research progress on midwifery competency and the implication for Chinese midwifery education
Xian ZHANG ; Hong LU ; Donghong WU
Chinese Journal of Practical Nursing 2016;32(31):2473-2476
Midwifery competency is the foundation for sustainable development of the midwifery profession. The promotion of midwives′ competency can improve their ability, strengthen midwifery competitiveness and enhance the quality of midwifery care services. This study gave an overview of the worldwide research progress on midwifery competency, we can draw the conclusion that there are urgent needs to improve midwifery education programs in China, emphasize competency-based midwifery education, as well as standardize the in-service training system to support the development of midwifery competency.
10.Study on Microbial Oil Production with Chlorella pyrenoidosa
Wei ZHANG ; Hong WU ; Min-Hua ZONG ;
Microbiology 1992;0(06):-
Chlorella pyrenoidosa No.2 was screened from five species of microalga Chlorella sp. for its higher lipid yield. Effects of medium components and culture conditions on cell growth as well as lipid ac-cumulation of C. pyrenoidosa No.2 were investigated and the results showed that the optimum medium rec-ipe was 20.0 g/L glucose,0.08 g/L glycine,1.0 g/L K2HPO4?3H2O,0.4 g/L MgSO4?7H2O and 0.004 g/L FeSO4?7H2O. The optimum culture temperature,initial pH,shaking rate and light intensity were 28℃,6.0,130 r/min and 650 Lux,respectively. Biomass and lipid content increased from 3.73 g/L and 40.15% to 6.56 g/L and 59.90% when Chlorella pyrenoidosa No.2 was cultivated under the above optimal conditions for 7 days,with lipid yield raised by 162%. Chlorella pyrenoidosa No.2 could produce lipid with xylose as carbon source,and so is potential for lipid production from renewable materials such as lignocellulose. GC analysis demonstrated that the fatty acid composition of the lipid was similar to that of vegetable oil and its unsaturated fatty acid content reached around 71%,thus it is a promising material for biodiesel production.