Objective:To isolate endophytic fungi from Panax ginseng and study their antifungal and antitumor activities.Methods:Endophytic fungi were isolated from 5-year-old garden ginseng and 15-year-old transplanted ginseng.The antifungal active endophytes were screened with Pyricularia oryzae P-2b model using mircodilution method,and the activities of endophytes against pathogenic fungi were tested in vitro.The antitumor activities of the endophytes were examined by MTT method in vitro.Results:Sixteen(33.3%)of the 48 endophytic fungi fully suppressed the activity of P.oryzae P-2b;11(22.9%)colonies showed satisfactory antifungal activities against Candida albicans,Cryptococcus neoformans,Trichophyton rubrum,and Aspergillus fumigatus;and 5(10.4%)colonies showed satisfactory antitumor activities against tumor cell lines MKN45,LOVO,HepG2,and HL-60.Among the bioactive colonies,Yuan-25 showed best antifungal activity,with its MIC80 aganinst Trichophyton rubrum being 4 mg/L,which was similar to that of fluconazole.Yuan-27 showed the best antitumor activity,with its IC50 similar to that of doxorubicin.Conclusion:Isolated endophytic fungi of Panax ginseng has antifungal and antitumor activities and is worth further exploring.

Three human leucine-rich repeats and immunoglobulin-like domains (LRIG) genes and proteins, named LRIG1-3, has been previously characterized and it was proposed that they may act as suppressors of tumor growth. The LRIG1 protein can inhibit the growth of tumors of glial cells and the down-regulation of the LRIG1 gene may be involved in the development and progression of the tumor. Real-time reverse transcription-polymerase chain reaction (RT-PCR) is a recently developed technique for quantitative assessment of specific RNA levels. In the current study, it was demonstrated that LRIG1-3 and EGFR mRNA was detected in human pituitary adenoma cell lines and a normal pituitary sample, with differences in the expression levels. Compared to the normal pituitary samples, the expression of LRIG1-3 in HP75 cell line was lower, but the expression of EGFR in HP75 cell line was higher. The results are consistent with LRIG1-3 being tumour suppressor genes, and LRIG genes decreasing the expression of EGFR. The ratio of EGFR/LRIG1 was increased at least 13-fold in HP75 cells compared with the normal pituitary cells, which was also the case for the ratio of EGFR/LRIG2 (14-fold increase in HP75) and EGFR/LRIG3 (11-fold increase in HP75). Further studies were needed to elucidate the explicit role of LRIG genes as negative regulators of oncogenesis in human pituitary adenoma.

Objective:To evaluate the efficacy and safety of dl-3-butylphthalide ( NBP) injection and soft capsules in the treat-ment of acute middle cerebral artery infarction. Methods:Sixty-one patients with acute cerebral infarction in the left middle cerebral artery in 72 hours of onset of ischemic stroke with score of 5-25 according to the national institutes of health stroke scale ( NIHSS) were randomly divided into the observation group (n=31) and the control group (n=30). The control group was treated with the routine treatment, while the observation group was sequentially treated with NBP injection and soft capsules additionally. The treatment course was 90 days. Before the treatment, the NIHSS score was evaluated in both groups to compare the neurologic impairment degree. After the treatment, the daily living skills assessment was performed by Barthel index ( BI) and modified Rankin score ( mRS) , and the ad-verse reactions were recorded. Results:Before the treatment, the NIHSS score in the two groups had no statistical significance ( P>0. 05). After the treatment, the BI in the observation group and the control group was (88. 55 ± 16. 74) and (70. 67 ± 26. 18), and mRS was (1. 87 ± 1. 02) and (2. 53 ± 1. 40), respectively, suggesting the observation group had more favorable outcome than the con-trol group (P≤0. 05). The incidence of adverse reactions had no significant difference between the groups. Conclusion: dl-3-Bu-tylphthalide sequential therapy should be regarded as an effective and safe method for acute cerebral infarction, which can improve the daily living skills and 90-day outcome of patients.

Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90％to 99.97％),followed by many other fungal groups(each ＜1.41％).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.

The pandemic of avian influenza viruses (AIVs) in Asia has caused enormous economic loss in poultry industry and human health threat, especially clade 2.3.4.4 H5 and H7 subtypes in recent years. The endemic chicken H6 virus in Taiwan has also brought about human and dog infections. Since wild waterfowls is the major AIV reservoir, it is important to monitor the diversified subtypes in wildfowl flocks in early stage to prevent viral reassortment and transmission. To develop a more efficient and sensitive approach is a key issue in epidemic control. In this study, we integrate multiplex reverse transcription recombinase polymerase amplification (RT-RPA) and capillary electrophoresis (CE) for high-throughput detection and differentiation of AIVs in wild waterfowls in Taiwan. Four viral genes were detected simultaneously, including nucleoprotein (NP) gene of all AIVs, hemagglutinin (HA) gene of clade 2.3.4.4 H5, H6 and H7 subtypes. The detection limit of the developed detection system could achieve as low as one copy number for each of the four viral gene targets. Sixty wild waterfowl field samples were tested and all of the four gene signals were unambiguously identified within 6 h, including the initial sample processing and the final CE data analysis.The results indicated that multiplex RT-RPA combined with CE was an excellent alternative for instant simultaneous AIV detection and subtype differentiation. The high efficiency and sensitivity of the proposed method could greatly assist in wild bird monitoring and epidemic control of poultry.

OBJECTIVETo identify the expression characteristics of the 1700001022RIK (RIKEN cDNA 1700001022) gene in mice and explore its function by bioinformatic analysis.

METHODSUsing the expression profile of gene microarray, we detected the expression of a new testis-specific gene, 1700001022RIK, in mice. We analyzed its expression characteristics in the testis tissue and their changes in different developmental stages of the testis by RT-PCR, real-time RT-PCR, Western blot, and immunohistochemistry. We performed bioinformatic analysis using a bioinformatic software.

RESULTSThe 1700001022RIK gene was specifically expressed in the mouse testis in an age-dependent manner, most highly in the adult mice. The 1700001022RIK protein was mainly expressed in the spermatogonia, spermatocytes, and round spermatids of the adult mice. Bioinformatic analysis showed that the 1700001022RIK protein amino acid sequence had a high similarity in human and mice, which indicated that this gene was highly conserved in mammals.

CONCLUSION1700001022RIK is a testis-specific gene mainly expressed in the spermatogonia, spermatocytes, and round spermatids of seminiferous tubules, which might be involved in the regulation of spermatogenesis.

Age Factors ; Animals ; Blotting, Western ; Computational Biology ; DNA, Complementary ; Gene Expression ; Genomics ; Male ; Mice ; Molecular Chaperones ; genetics ; Seminiferous Tubules ; Spermatids ; Spermatocytes ; Spermatogenesis ; genetics ; Spermatogonia ; Testis

Atrioventricular Block ; etiology ; Cardiac Catheterization ; adverse effects ; Heart Septal Defects, Ventricular ; therapy ; Hematologic Diseases ; etiology ; Hemolysis ; Humans

Adult ; Hemophilia A ; complications ; Humans ; Leukemia, Promyelocytic, Acute ; complications ; Male

OBJECTIVETo observe the effect of traditional Chinese medicine (TCM) in improving quality of life of patients with non-small cell lung cancer (NSCLC) in III or IV stage, for establishing TCM therapeutic regimen on late NSCLC.

METHODSA total of 294 patients in 6 hospitals were randomly assigned into three groups, 99 in the TCM group treated with TCM according to disease and syndrome differentiation, 92 treated with chemotherapy in the western group and 103 treated with combined therapy of TCM and chemotherapy in the integrative group. Six items, including physical status, social/family status, intercourse with physicians, emotional status, functional status and additional concerning status, were investigated and analyzed by using Functional Assessment of Cancer Therapy-lung (FACT-L).

RESULTSThe scores of social/family status and intercourse with physicians were insignificantly different in all three groups before and after treatment (P > 0.05). The improvement of physical status in the TCM group, and that of emotional status, functional status and additional concerned status in the integrative medicine group were superior to those in the other groups (P< 0.05).

CONCLUSIONTCM has certain antagonistic effect on the adverse reaction of chemotherapy, and it can improve the quality of life of patients to certain extent.

Adult ; Aged ; Aged, 80 and over ; Antineoplastic Combined Chemotherapy Protocols ; therapeutic use ; Carcinoma, Non-Small-Cell Lung ; drug therapy ; Diagnosis, Differential ; Drugs, Chinese Herbal ; therapeutic use ; Female ; Humans ; Lung Neoplasms ; drug therapy ; Male ; Medicine, Chinese Traditional ; Middle Aged ; Phytotherapy ; Prospective Studies ; Quality of Life

OBJECTIVETo evaluate the effect of branch chain amino acid (BCAA) enriched formula on nutritional status and postoperative fatigue for digestive surgery patients.

METHODSForty patients who underwent digestive surgery were randomly received parenteral nutrition with either BCAA enriched (study group, n=20) or routine amino acid (control group, n=20) for seven consecutive days. Nitrogen balance,serum total protein, albumin, prealbumin, transferrin, retinol binding protein and postoperative fatigue score were monitored during the postoperative period.

RESULTSThe cumulative postoperative fatigue scores were lower in BCAA group than that in the control group at the 4th, 5th and 7th day after operation (P< 0.05). Patients achieved positive nitrogen balance 2 days earlier in the study group than that in the control group, but there was no significant difference in cumulative nitrogen balance between the two groups. There was no significant difference in elevation of serum total protein, albumin, prealbumin, transferrin at the 7th day after operation between the two groups (P > 0.05), compared with those at the first day after operation. The serum level of retinol binding protein was higher in BCAA-enriched group than that in the control group (P=0.004).

CONCLUSIONTPN with BCAA enriched formula can reduce postoperative fatigue score and improve the nutritional status for digestive surgery patients.

Adult ; Aged ; Amino Acids, Branched-Chain ; therapeutic use ; Digestive System Surgical Procedures ; adverse effects ; Fatigue ; etiology ; therapy ; Female ; Humans ; Male ; Middle Aged ; Nutritional Status ; Parenteral Nutrition ; Postoperative Period