1.Isolation of endophytic fungi from Panax ginseng and their antifungal and antitumor activities in vitro
Lili XU ; Ting HAN ; Lin LI ; Luping QIN
Academic Journal of Second Military Medical University 1985;0(06):-
Objective:To isolate endophytic fungi from Panax ginseng and study their antifungal and antitumor activities.Methods:Endophytic fungi were isolated from 5-year-old garden ginseng and 15-year-old transplanted ginseng.The antifungal active endophytes were screened with Pyricularia oryzae P-2b model using mircodilution method,and the activities of endophytes against pathogenic fungi were tested in vitro.The antitumor activities of the endophytes were examined by MTT method in vitro.Results:Sixteen(33.3%)of the 48 endophytic fungi fully suppressed the activity of P.oryzae P-2b;11(22.9%)colonies showed satisfactory antifungal activities against Candida albicans,Cryptococcus neoformans,Trichophyton rubrum,and Aspergillus fumigatus;and 5(10.4%)colonies showed satisfactory antitumor activities against tumor cell lines MKN45,LOVO,HepG2,and HL-60.Among the bioactive colonies,Yuan-25 showed best antifungal activity,with its MIC80 aganinst Trichophyton rubrum being 4 mg/L,which was similar to that of fluconazole.Yuan-27 showed the best antitumor activity,with its IC50 similar to that of doxorubicin.Conclusion:Isolated endophytic fungi of Panax ginseng has antifungal and antitumor activities and is worth further exploring.
2.Down-regulation of leucine-rich repeats and immunoglobulin-like domain proteins (LRIG1-3) in HP75 pituitary adenoma cell line.
Dongsheng, GUO ; Lin, HAN ; Kai, SHU ; Jian, CHEN ; Ting, LEI
Journal of Huazhong University of Science and Technology (Medical Sciences) 2007;27(1):91-4
Three human leucine-rich repeats and immunoglobulin-like domains (LRIG) genes and proteins, named LRIG1-3, has been previously characterized and it was proposed that they may act as suppressors of tumor growth. The LRIG1 protein can inhibit the growth of tumors of glial cells and the down-regulation of the LRIG1 gene may be involved in the development and progression of the tumor. Real-time reverse transcription-polymerase chain reaction (RT-PCR) is a recently developed technique for quantitative assessment of specific RNA levels. In the current study, it was demonstrated that LRIG1-3 and EGFR mRNA was detected in human pituitary adenoma cell lines and a normal pituitary sample, with differences in the expression levels. Compared to the normal pituitary samples, the expression of LRIG1-3 in HP75 cell line was lower, but the expression of EGFR in HP75 cell line was higher. The results are consistent with LRIG1-3 being tumour suppressor genes, and LRIG genes decreasing the expression of EGFR. The ratio of EGFR/LRIG1 was increased at least 13-fold in HP75 cells compared with the normal pituitary cells, which was also the case for the ratio of EGFR/LRIG2 (14-fold increase in HP75) and EGFR/LRIG3 (11-fold increase in HP75). Further studies were needed to elucidate the explicit role of LRIG genes as negative regulators of oncogenesis in human pituitary adenoma.
3.Efficacy Observation of dl-3-Butylphthalide in the Sequential Treatment of Acute Middle Cerebral Artery Infarction
Yungang CAO ; Ting YANG ; Man QU ; Xianda LIN ; Linlei ZHANG ; Zhao HAN
China Pharmacist 2016;19(10):1889-1890,1896
Objective:To evaluate the efficacy and safety of dl-3-butylphthalide ( NBP) injection and soft capsules in the treat-ment of acute middle cerebral artery infarction. Methods:Sixty-one patients with acute cerebral infarction in the left middle cerebral artery in 72 hours of onset of ischemic stroke with score of 5-25 according to the national institutes of health stroke scale ( NIHSS) were randomly divided into the observation group (n=31) and the control group (n=30). The control group was treated with the routine treatment, while the observation group was sequentially treated with NBP injection and soft capsules additionally. The treatment course was 90 days. Before the treatment, the NIHSS score was evaluated in both groups to compare the neurologic impairment degree. After the treatment, the daily living skills assessment was performed by Barthel index ( BI) and modified Rankin score ( mRS) , and the ad-verse reactions were recorded. Results:Before the treatment, the NIHSS score in the two groups had no statistical significance ( P>0. 05). After the treatment, the BI in the observation group and the control group was (88. 55 ± 16. 74) and (70. 67 ± 26. 18), and mRS was (1. 87 ± 1. 02) and (2. 53 ± 1. 40), respectively, suggesting the observation group had more favorable outcome than the con-trol group (P≤0. 05). The incidence of adverse reactions had no significant difference between the groups. Conclusion: dl-3-Bu-tylphthalide sequential therapy should be regarded as an effective and safe method for acute cerebral infarction, which can improve the daily living skills and 90-day outcome of patients.
4.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
5.Combination of multiplex reverse transcription recombinase polymerase amplification assay and capillary electrophoresis provides high sensitive and high-throughput simultaneous detection of avian influenza virus subtypes
Shou-Kuan TSAI ; Chen-Chih CHEN ; Han-Jia LIN ; Han-You LIN ; Ting-Tzu CHEN ; Lih-Chiann WANG
Journal of Veterinary Science 2020;21(2):e24-
The pandemic of avian influenza viruses (AIVs) in Asia has caused enormous economic loss in poultry industry and human health threat, especially clade 2.3.4.4 H5 and H7 subtypes in recent years. The endemic chicken H6 virus in Taiwan has also brought about human and dog infections. Since wild waterfowls is the major AIV reservoir, it is important to monitor the diversified subtypes in wildfowl flocks in early stage to prevent viral reassortment and transmission. To develop a more efficient and sensitive approach is a key issue in epidemic control. In this study, we integrate multiplex reverse transcription recombinase polymerase amplification (RT-RPA) and capillary electrophoresis (CE) for high-throughput detection and differentiation of AIVs in wild waterfowls in Taiwan. Four viral genes were detected simultaneously, including nucleoprotein (NP) gene of all AIVs, hemagglutinin (HA) gene of clade 2.3.4.4 H5, H6 and H7 subtypes. The detection limit of the developed detection system could achieve as low as one copy number for each of the four viral gene targets. Sixty wild waterfowl field samples were tested and all of the four gene signals were unambiguously identified within 6 h, including the initial sample processing and the final CE data analysis.The results indicated that multiplex RT-RPA combined with CE was an excellent alternative for instant simultaneous AIV detection and subtype differentiation. The high efficiency and sensitivity of the proposed method could greatly assist in wild bird monitoring and epidemic control of poultry.
6.Expression of a testis-specific gene 1700001022RIK in mice and its bioinformatic analysis.
Yu-chi LI ; Shou-ren LIN ; Man-ling LUO ; Huan GUO ; Han-wei WU ; Zhi-mao JIANG ; Yao-ting GUI
National Journal of Andrology 2015;21(5):391-395
OBJECTIVETo identify the expression characteristics of the 1700001022RIK (RIKEN cDNA 1700001022) gene in mice and explore its function by bioinformatic analysis.
METHODSUsing the expression profile of gene microarray, we detected the expression of a new testis-specific gene, 1700001022RIK, in mice. We analyzed its expression characteristics in the testis tissue and their changes in different developmental stages of the testis by RT-PCR, real-time RT-PCR, Western blot, and immunohistochemistry. We performed bioinformatic analysis using a bioinformatic software.
RESULTSThe 1700001022RIK gene was specifically expressed in the mouse testis in an age-dependent manner, most highly in the adult mice. The 1700001022RIK protein was mainly expressed in the spermatogonia, spermatocytes, and round spermatids of the adult mice. Bioinformatic analysis showed that the 1700001022RIK protein amino acid sequence had a high similarity in human and mice, which indicated that this gene was highly conserved in mammals.
CONCLUSION1700001022RIK is a testis-specific gene mainly expressed in the spermatogonia, spermatocytes, and round spermatids of seminiferous tubules, which might be involved in the regulation of spermatogenesis.
Age Factors ; Animals ; Blotting, Western ; Computational Biology ; DNA, Complementary ; Gene Expression ; Genomics ; Male ; Mice ; Molecular Chaperones ; genetics ; Seminiferous Tubules ; Spermatids ; Spermatocytes ; Spermatogenesis ; genetics ; Spermatogonia ; Testis
9.Endophytic fungi from Ginkgo biloba and their biological activities.
Hongsheng YU ; Lei ZHANG ; Lin LI ; Wenchao LI ; Ting HAN ; Liangdong GUO ; Luping QIN
China Journal of Chinese Materia Medica 2010;35(16):2133-2137
OBJECTIVETo research the isolation method, identification and screen for bioactivities endophytic fungi from ginkgo.
METHODEndophytic fungi from ginkgo were separated. By means of microdilution method, activities of endophytes against pathogenic fungi were tested. Then, using DPPH, the antioxidant activities were measured.
RESULTNine strains (16.1%) showed antifungal activities against Candida albicans, Cryptococcus neoformans, Trichophyton rubrum and Aspergillus fumigatus. Among these bioactive strains, the growth of T. rubrum was strongly inhibited by T-1-2-1, as the MIC80 was equal to fluconazole, the positive control. Five strains (8.9%) showed antioxidant activities. Among them sample T-3-2-2 and T-6-5-7 showed the strongest antioxidant activities.
CONCLUSIONEndophytic fungi of ginkgo would be potential and rich resources for drug development.
Antifungal Agents ; pharmacology ; Aspergillus fumigatus ; drug effects ; Candida albicans ; drug effects ; Cryptococcus neoformans ; drug effects ; Fluconazole ; pharmacology ; Fungi ; chemistry ; drug effects ; isolation & purification ; Ginkgo biloba ; microbiology ; Microbial Sensitivity Tests ; Trichophyton ; drug effects
10.Chemical constituents from marine fungus Penicillium thomii.
Ting JIANG ; Li TIAN ; Ai-hua GUO ; Hong-zheng FU ; Yue-hu PEI ; Wen-han LIN
Acta Pharmaceutica Sinica 2002;37(4):271-274
AIMTo investigate the bioactive constituents from the mycelium of Penicillium thomii. Which isolated from Anemone collected in Qingdao beach.
METHODSThe constituents were separated by using various chromatography and the structures were identified on the basis of extensive spectral analysis.
RESULTSFive compounds, namely penicillixanthone A (I), p-methylbenzolic acid (II), 1-O-hexadecanoyl-2-O-(9-octadecenoyl)-3-O-(9, 12-octadecadienoyl) glycerol (III), 5 alpha, 8 alpha-epidioxy-24 zeta-methylcholesta-6, 22-dien-3 beta-ol (IV) and 1, 6, 8-trihydroxyl-3-methyl-9, 10-anthracenedione (V), were isolated from the mycelium of Penicillium thomii.
CONCLUSIONPenicillixanthone A is a new compound, while the others are isolated from Penicillium thomii for the first time.
Animals ; Molecular Conformation ; Molecular Structure ; Penicillium ; chemistry ; isolation & purification ; Sea Anemones ; microbiology ; Xanthones ; chemistry ; isolation & purification