1.Primitive neuroectodermal tumor of kidney: report of a case.
Shu-yong HAN ; Yun-ting XIE ; Ren-ya ZHANG ; Peng ZHU
Chinese Journal of Pathology 2007;36(3):213-214
12E7 Antigen
;
Adult
;
Antigens, CD
;
metabolism
;
Cell Adhesion Molecules
;
metabolism
;
Diagnosis, Differential
;
Humans
;
Immunohistochemistry
;
Kidney
;
metabolism
;
pathology
;
Kidney Neoplasms
;
metabolism
;
pathology
;
surgery
;
Male
;
Nephrectomy
;
Neuroectodermal Tumors, Primitive
;
metabolism
;
pathology
;
surgery
;
Vimentin
;
metabolism
;
Wilms Tumor
;
pathology
2.The relationship between waist to stature ratio and hypertension, diabetes, and dyslipidemia in Qingdao
Yuan JING ; Yanhu DONG ; Ting HAN ; Lei ZHANG ; Na WANG ; Yamei ZHU ; Meihua XU
Chinese Journal of Internal Medicine 2012;51(9):683-686
ObjectiveTo evaluate the relationship between waist to stature ratio (WSR) and hypertension,diabetes,dyslipidemia in Qingdao. MethodsData were collected from a 2001 - 2007 Qingdao area diabetes survey,population-based cross-sectional study,and 30 712 Chinese adults aged > 18 years old were enrolled.Correlation analysis of BMI,WSR,hip circumference,waist circumference,waist to hip ratio (WHR) with blood glucose,blood pressure,blood lipid were conducted.ROC curve analysis in diabetes,bypertension,dyslipidemia and multivariate logistic regression analysis were also conducted.ResultsAnthropometric indicators were related with hypertension,diabetes and dyslipidemia in both men and women.Comparing with other anthropometric indicators,WSR was found to have the largest area under the ROC curve and the best cut-off point of WSR was 0.52.Multivariate logistic regression analysis showed that, after controlling age, disease history, physicalactivity, sex, thediabeteshypertension and dyslipidemia risk OR of WSR≥0.52 were largest.ConclusionsAnthropometric indicators intimately related with cardiovascular risk factors in Qingdao region,and may predict and evaluate the risk of cardiovascular disease.WSR may be the best index for predicting cardiovascular risk factors in Qingdao area.The optimal WSR cut off point for identifying cardiovascular risk factors clustering is 0.52.
3.Effect of Hydrogen Peroxide on Microstructure of Mice Kidney
quan-xiang, MA ; ze-shan, MAO ; xiang-shan, YUAN ; jin-zhu, HAN ; ting-tong, YANG
Journal of Applied Clinical Pediatrics 1992;0(05):-
Objective To study the effect of hydrogen peroxide on microstructure of mice kidney and discuss the toxic effect on mice kidney.Methods Thirty healthy male mice of Kunming Genus were divided into 3 groups at random:control group and two experimental groups. Running water was fed to control group for 10 days while 0.3,3 g/L hydrogen peroxide running water readily prepared was fed to the experimental groups for 10 days. On the 10th day,the kidneys were taken out,and fixed in the fixation solutions,conventionally produced and stained.Finally,they were studied under the optical microscope.Results Experimental groups:in the kidney tissue cytoplasm of proximal convoluted tubule showed hydropic degeneration and vacuolation which depend on dose of hydrogen peroxide.Conclusion Toxic effect on mice kidney can be caused by hydrogen peroxide.
4.Cloning and functional characterization of α 7 nicotinic acetylcholine receptor molecular chaperone Tmem35a
Zi-han WANG ; Jin-peng YU ; Dong-ting ZHANGSUN ; Xiao-peng ZHU ; Su-lan LUO
Acta Pharmaceutica Sinica 2024;59(7):1993-2001
Nicotinic acetylcholine receptors (nAChRs) belong to ligand-gated ion channel receptors, of which
5.Confrontation as a Mediator between Sense of Coherence and Self-management Behaviors among Elderly Patients with Coronary Heart Disease in North China.
Zhenyun LI ; Ting LIU ; Jing HAN ; Ting LI ; Qina ZHU ; Aimin WANG
Asian Nursing Research 2017;11(3):201-206
PURPOSE: Self-management is critical to improve health outcomes of elderly patients with coronary heart disease (CHD). Sense of coherence (SOC) is found to be linked with self-management behaviors. However, their deeper relationship is not clear. The purposes of this study were to investigate the association between SOC and self-management behaviors among elderly CHD patients in China, and whether confrontation mediates this association. METHODS: A cross-sectional design was used. A total of 275 elderly patients with CHD recruited from the cardiology department in a general hospital in North China were surveyed from October 2015 to April 2016. SOC, confrontation, and self-management behaviors were measured using the Chinese version of the SOC scale, subscale of Medical Coping Modes Questionnair—Confrontation, and the CHD self-management scale, respectively. Correlation analysis and path analysis were conducted to analyze the data. RESULTS: The mean (±standard deviation) scores of SOC, confrontation, and self-management behaviors were 62.20 (±9.61), 19.55 (±3.15), and 76.17 (±10.63), respectively. Correlation analysis showed that SOC, confrontation, and self-management behaviors were significantly correlated with each other. Path analysis indicated that SOC exerted a direct effect on self-management behaviors, whereas could affect self-management indirectly via confrontation. Bootstrap test result showed that confrontation played a mediating role (β = .20, p < .001) in the relationship between SOC and self-management behaviors. CONCLUSION: SOC was related to self-management behaviors, whereas confrontation mediated the effect of SOC on self-management behaviors. In practice, the role of confrontation coping should be valued when developing strategies to strengthen SOC and to improve self-management practice among elderly CHD patients.
Aged*
;
Asian Continental Ancestry Group
;
Cardiology
;
China*
;
Coronary Disease*
;
Hospitals, General
;
Humans
;
Negotiating
;
Self Care*
;
Sense of Coherence*
6.Translation of acupoint terms and inheritance of traditional Chinese medicine culture.
Han-Ting ZHU ; Ya-Ping LI ; Fang-Zi ZHENG
Chinese Journal of Integrated Traditional and Western Medicine 2008;28(6):556-557
The present condition in the acupoint term translation was analyzed and its existent problems in this area were discussed in this paper. The authors suggested that in translating the terms of acupoints, the translation on the meaning of the acupoints should be added, in this way, it can not only keep the integrity in acupoint translation, but also make the inheritance of the Chinese precious culture of Traditional Chinese Medicine further available.
Acupuncture Points
;
Animals
;
Culture
;
Humans
;
Medicine, Chinese Traditional
;
Translating
7.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
8.Primary targeting of functional regions involved in transcriptional regulation on watermelon fruit-specific promoter WSP.
Han-Ying WU ; Jing-Mei LIU ; Xin-Ting YANG ; Zhu-Jun ZHU ; Sen-Yan SHOU
Chinese Journal of Biotechnology 2003;19(2):227-230
Fruit ripening is associated with a number of physiological and biochemical changes. They include degradation of chlorophyll, synthesis of flavor compounds, carotenoid biosynthesis, conversion of starch to sugars, cell wall solublisation and fruit softening. These changes are brought about by the expression of specific genes. People are interested in the molecular mechanism involved in the regulation of gene transcription during fruit ripening. Many fruit-specific promoters such as PG, E4, E8, and 2A11 have been characterized and shown to direct ripening-specific expression of reporter genes. AGPase plays the key role in catalyzing the biosynthesis of starch in plants. It is a heterotetrameric enzyme with two small subunits and two large subunits, which are encoded by different genes. In higher plants, small subunits are highly conserved among plant species and expressed in all tissues. And the large subunits are present at multiple isoforms and expressed in a tissue-specific pattern. In fruits, the expression pattern of the large subunits varies with plant species. That made it important to study the transcriptional regulation of the large subunits of AGPase in different plant species. Northern-blot analysis indicates in watermelon, an isoform of the large subunits Wml1 expressed specifically in fruits, not in leaves. The 5' flanking region of Wml1, which covers 1573bp, has been isolated through the method of uneven PCR. And transient expression assay has shown that the 1573bp (named WSP) can direct fruit-specific expression of GUS gene. Our goal in this study was to scan the promoter region for main regulatory regions involved in fruit-specific expression. A chimaeric gene was constructed containing the WSP promoter, the beta-glucuronidase (GUS) structural sequence as a reporter gene and the nopaline synthase polyadenylation site (NOS-ter). The plasmid pSPA was digested with Hind III + Hinc II and promoter fragment of 1573bp (from 180bp to 1752bp) was cut out and cloned into Sma I sites of pBluescript SK(-), to produce pBSPA-16. The same insert was then cut out with Hind III + BamH I, and ligated with transient expression vector pBI426 digested by HindIII + Bgl II to produce pISPA-16. Three 5'-end deletions of the promoter were obtained and fused to GUS gene in plant transient expression vector pBI426: the 1201bp fragment (from 551bp to 1752bp) was generated by digestion of pBSPA-16 with BamH I + SnaB I, the 898bp fragment (from 854bp to 1752bp) by BamH I + EcoRV. Both fragments were ligated with pBluescript SK(-) digested by BamH I + Sma I, to produce pBSPA-12 and pBS-PA-9. The inserts were cut out with HindmIII + BamH I and ligated with pBI426 digested by Hind III + Bgl II, to produce pISPA-12 and pISPA-9. The 795bp fragment (from 957bp to 1752bp) was generated by digestion of pSPA with Hinc II + EcoR I, promoter fragment was cut out and cloned into Sma I sites of pBluescript SK(-), to produce pBSPA-8. The same insert were cut out with Hind III + BamH I, and ligated with transient expression vector pBI426 digested by Hind III + Bgl II. The 1573bp fragment and three 5'-end deletions were delivered into watermelon leaf, stem, flower and fruit of different development stages (5, 10, 20 days after pollination) via particle bombardment using a biolistic PDS-1000/He particle gun. Bombardment parameters were as follows: a helium pressure of 1200 psi, vacuum of 91432.23Pa, 7 cm between the stopping screen and the plate. Histochemical assay were done on all the tissues bombarded after incubation for 2 days. The 1573bp fragment had the strongest promoter activity, and can induce GUS expression in fruits of 5 and 20 days after anthesis and flowers, but not in fruits of 10 days after anthesis, leaves and stems. Fragments of 1201bp and 898bp can induce GUS expression only in fruits of 20 days after anthesis, and with lower expression levels than 1573bp. Fragment of 795bp was not able to direct GUS expression in any of the tissues bombarded (data not shown). It can be concluded that of the 1573bp, 1201 bp, 898bp Wml1 5'flanking regions include the necessary information directing fruit-specific expression. Deletion from 180bp to 551bp doesn't affect the fruit-specificity of the promoter, but lowered the expression level. There may be some cis-acting elements located in this region, which can enhance external gene expression in later stages of fruit development. Deletion from 854bp and 958bp led to loss of GUS expression. This region includes the necessary information needed for gene expression as well as the regulatory elements for fruit-specific transcription.
Citrullus
;
genetics
;
Fruit
;
genetics
;
Gene Expression Regulation, Plant
;
genetics
;
Promoter Regions, Genetic
;
genetics
;
Regulatory Sequences, Nucleic Acid
;
genetics
;
physiology
9.Small incision decompression in surgical treatment of leg fracture.
Xin-Gong LIU ; Yi-Ting HAN ; Qun-Li DUAN-MU ; Hong ZHU ; Dong-Hui HUANG ; Qi-Hui ZHAO
China Journal of Orthopaedics and Traumatology 2008;21(5):372-373
Adult
;
Aged
;
Aged, 80 and over
;
Decompression, Surgical
;
Female
;
Fractures, Bone
;
complications
;
surgery
;
Humans
;
Leg Injuries
;
complications
;
surgery
;
Male
;
Middle Aged
10.Effect of traditional Chinese medicine in improving quality of life of patients with non-small cell lung cancer in late stage.
Li-zhu LIN ; Dai-han ZHOU ; Xin-ting ZHENG
Chinese Journal of Integrated Traditional and Western Medicine 2006;26(5):389-393
OBJECTIVETo observe the effect of traditional Chinese medicine (TCM) in improving quality of life of patients with non-small cell lung cancer (NSCLC) in III or IV stage, for establishing TCM therapeutic regimen on late NSCLC.
METHODSA total of 294 patients in 6 hospitals were randomly assigned into three groups, 99 in the TCM group treated with TCM according to disease and syndrome differentiation, 92 treated with chemotherapy in the western group and 103 treated with combined therapy of TCM and chemotherapy in the integrative group. Six items, including physical status, social/family status, intercourse with physicians, emotional status, functional status and additional concerning status, were investigated and analyzed by using Functional Assessment of Cancer Therapy-lung (FACT-L).
RESULTSThe scores of social/family status and intercourse with physicians were insignificantly different in all three groups before and after treatment (P > 0.05). The improvement of physical status in the TCM group, and that of emotional status, functional status and additional concerned status in the integrative medicine group were superior to those in the other groups (P< 0.05).
CONCLUSIONTCM has certain antagonistic effect on the adverse reaction of chemotherapy, and it can improve the quality of life of patients to certain extent.
Adult ; Aged ; Aged, 80 and over ; Antineoplastic Combined Chemotherapy Protocols ; therapeutic use ; Carcinoma, Non-Small-Cell Lung ; drug therapy ; Diagnosis, Differential ; Drugs, Chinese Herbal ; therapeutic use ; Female ; Humans ; Lung Neoplasms ; drug therapy ; Male ; Medicine, Chinese Traditional ; Middle Aged ; Phytotherapy ; Prospective Studies ; Quality of Life