Objective To evaluate the effect of prefilling blood reservoir with mannitol-adeninephosphate MAP) solution on the damage to erythrocytes in intraoperative salvaged blood in patients.Methods One hundred and fifty blood samples were collected from 150 patients who were scheduled for elective spinal surgery requiring blood salvage,and were equally and randomly divided into 5 groups (n =30 each) using a random number table:group N,group N1,group N2,group M1 and group M2.The blood reservoir was not prefilled before surgery in group N,while the blood reservoirs in N1,N2,M1 and M2 groups were prefilled with normal saline (NS) 100 ml,NS 200 ml,MAP solution 100 ml and MAP solution 200 ml,respectively.Blood sauples were obtained for erythrocyte osmotic fragility test after the salvaged blood was washed,and hemolysis rates in different concentrations of hypotonic NaCl solution were calculated.The concentration of free hemoglobin in the clear supernatant liquid (FHb) of washed blood placed for 0 h (T0),1 h (T1) and 2 h (T2) were detected.Results Compared with N and N1 groups,the hemolysis rate of washed erythrocytes under 0.48％ 0.68％ NaCl solutions was significantly decreased,the concentration of FHb at T1 was decreased,and no significant change was found in FHb at T2 in group M1.Compared with N and N2 groups,the haemolysis rates of washed erythrocytes under 0.48％-0.68％ NaCl solutions were significantly decreased,and the concentrations of FHb at T1,2 were decreased in group M2.The concentration of FHb was significantly lower at T2 in group M2 than in group M1.Conclusion Prefilling blood reservoir with MAP solution can mitigate the damage to erythrocytes in the intraoperative salvaged blood in patients,and the efficacy of prefilling of 200 ml is superior to that of prefilling of 100 ml.

Objective:To observe the effect of protoscolex on Th subsets and correlative cytokine in mice spleen cells in vitro.Methods:Co-culture spleen cells from BALB/c mice with protoscolices,then IL-4,IFN-γand TGF-βproduction in cell culture supernatants were analyzed by ELISA.The percentage of Th subsets were detected by Flow Cytometry analysis.Results:Secretion levels of IL-4 and TGF-βwere significantly increased in spleen cells at different time point in co-culture system with protoscolices.Ratios of Th2 and Treg cells were also significantly increased in co-culture system at different time points than the control groups.However,there was no statistical significance for ratio of Th1 cells at different time points.Conclusion:The protoscolex can increase the ratios of Th2 cells and Treg cells from spleen cells.Secretion levels of IL-4 and TGF-βwere also increased in spleen cells co-cultured with protosco-lices.The results suggest that these Th cell subsets play a role in the immune escape of the hydatid disease.

Objective:To investigate the expression levels of PPARα/γin RAW264. 7 cells in the early stages of co-cultivation with Echinococcus granulosus in vitro. Methods:RAW264. 7 cells were co-cultured with E. granulosus and collected at 12,24,36,48, 72 h. The mRNA levels of PPAR-γ,PPAR-α,M1 macrophages-associated cytokines including TNF-α,MCP-1 and IL-1β,and M2 mac-rophages-associated cytokines including Arg-1,TGF-β and Fizz-1 were detected by qRT-PCR. The protein levels of Arg-1 and MR were analyzed by ELISA. Results:The expression levels of PPAR-γ, PPAR-αand the M2 macrophages-associated cytokines including Arg-1,TGF-β,Fizz-1 and MR were significantly increased,especially at 72 h (P<0. 05). M1 macrophages-associated cytokines including TNF-α,MCP-1 and IL-1β were decreased at 72h although increased at first. Conclusion:During the early stages of co-cultivation with Echinococcus granulosus in vitro, the levels of PPAR-γ/α are up-regulated in RAW264. 7 cells, which may drive macrophage polarization and play a role in the immune escape.

Objective To evaluate effects of artesunate on rosacea-like inflammation in mouse models.Methods Twenty-five male BALB/c mice aged 7 weeks were injected subcutaneously with 40 μ1 antibacterial peptide LL-37 into the back once every 12 hours for 4 sessions to establish mouse models with rosacea-like inflammation.These 25 mice were randomly and equally divided into 5 groups:after each injection of LL-37,model group were gavaged with sodium chloride physiological solution,treatment groups gavaged with 25,50 and 100 mg/kg artesunate solution separately,and positive control group gavaged with 30 mg/kg doxycycline hydrochloride solution.Another 5 healthy mice injected subcutaneously with pure water into the back for 4 sessions served as blank control group.Forty-eight hours after the initial injection of LL-37,changes in skin lesions and the intensity of erythema were assessed.Skin tissues at the dorsal injection site were resected and subjected to HE staining,the tissue structure was observed and the number of inflammatory cells was counted.Enzyme-linked immunosorbent assay (ELISA) was performed to estimate the activity of myeloperoxidase (MPO) in skin lesions.Results The model group showed obvious inflammatory reactions,and significantly increased erythema score (3.20 ± 0.84),inflammatory cell count (517.27 ± 99.43) and MPO activity (0.57 ± 0.08) compared with the blank control group (all P ＜ 0.01).The positive control group showed significantly decreased erythema score (1.60 ± 0.89),inflammatory cell count (270.93 ± 124.63) and MPO activity (0.40 ± 0.05) compared with the model group (P ＜ 0.05,0.01,0.01,respectively).Moreover,the erythema score,inflammatory cell counts and MPO activity were all significantly lower in 50-(1.80 ± 0.84,286.00 ± 33.72,0.43 ± 0.05,respectively) and 100-mg/kg artesunate groups (1.40 ± 0.55,258.00 ± 36.44,0.40 ± 0.06,respectively) than in the model group (P ＜ 0.05 or 0.01).However,there were no significant differences in the erythema score,inflammatory cell count and MPO activity between 50-or 100-mg/kg artesunate group and the positive control group (P ＞ 0.05).Conclusion Artesunate can inhibit rosacea-like inflammatory reactions in mouse models,especially the middle-and high-dose artesunate.

Objective:To understand the expression levels of Tim-3,a new proinflammatory factor in the early stages of Echinococcus granulosus infection in mice.Methods: BALB/c mice were infected with E.granulosus.Peritoneal macrophages and spleen cells were collected at 1,5,9 and 13 days post-infection.At different time points ,the levels of Tim-3 in peritoneal macrophages and spleen CD3+lymphocyte subsets were detected by FCM , and the relative expression of TLR 4 mRNA was detected by qRT-PCR.Results:There was no significant difference in the expression levels of Tim-3 of CD3+spleen lymphocyte subsets between E.granulosus group and control group (P>0.05).The expression levels of Tim-3 of spleen macrophages (9,13 days) and peritoneal macrophage (5,9,13 days) were much higher in E.granulosus infected group than those in control group with statistical significance (P<0.05).The numbers of macrophages were no change.Compared with control groups,the relative expression of TLR4 mRNA at 1 day post-infection was statistically higher in E.granulosus infected group ( P<0.05 ).Conclusion:During early stage of E.granulosus infection in mice,the levels of Tim-3 expression are upregulated,while the expression of TLR4 are downregulated,which may inhibit the function of macrophages resulting in host-immunity-defensive-system inhibition and immune tolerance of E.granulosus to host.

Objective:To compare the efficacy of individualized PEEP determined by lung electrical impedance tomography (EIT) and dynamic lung compliance (Cdyn) during lung-protective ventilation strategies in the patients undergoing general anesthesia.Methods:Sixty patients of both sexes, aged 18-64 yr, of American Society of Anesthesiologists physical status Ⅰor Ⅱ, with body mass index of 18.5-28.0 kg/m 2, undergoing elective surgery with general anesthesia and endotracheal intubation in the Second Affiliated Hospital of Soochow University, were selected.Lung-protective ventilation strategy was applied in supine position after general anesthesia.The peak value of PEEP did not exceed 10 cmH 2O, with an increment/decrement of 2 cmH 2O for titration.The corresponding Cdyn value and lung EIT data were collected during titration.The patients were divided into 2 groups ( n=30 each) using a random number table method: titration first increased and then decreased group (group A) and titration first decreased and then increased group (group B). The determination method of individualized PEEP: Cdyn method was the PEEP corresponding to the maximum Cdyn value; EIT method was obtained through PV500 PC software analysis.The level and success rate of individualized PEEP determined by the Cdyn and EIT methods were compared, and the ICC consistency analysis of the determined individualized PEEP was performed. Results:Compared with the Cdyn method, the success rate of individualized PEEP determined by EIT method was significantly increased, and the level of individualized PEEP was decreased in the two group ( P<0.05). In group A, the individualized PEEP titrated by the EIT and Cdyn methods showed good agreement (the ICC value of the increment-Cdyn and increment-EIT methods was 0.761, P<0.05; the ICC value of the decrement-Cdyn and decrement-EIT methods was 0.763, P<0.05). In group B, the individualized PEEP titrated by the EIT and Cdyn methods showed good agreement (the ICC value of the increment-Cdyn and increment-EIT methods was 0.809, P<0.05; the ICC value of the decrement-Cdyn and decrement-EIT methods was 0.797, P<0.05). Conclusion:The agreement between the individualized PEEP determined by lung EIT method and Cdyn method during lung-protective ventilation is good in the patients undergoing general anesthesia, and the success rate of EIT method is higher, and the level of individualized PEEP is lower.

Objective To discuss the safety and short-term efficacy of MR-guided focused ultrasound surgery (MRgFUS) for pain palliation of bone metastases patients.Methods Fourteen patients with painful bone metastases were recruited in this prospective study.The treating efficacy was characterized by numerical rating scale (NRS),the brief pain inventory quality of life (BPI-QOL) survey,and Karnosky performance status scale (KPS).Adverse events occurred pre-and post-treatment were analyzed.Normal distributed statistics was analyzed by using paired-samples t test or Wilcoxon rank sum test.Results Fourteen patients were treated with MRgFUS,2 patients dropped out of the study.The NRS ratings are 6.50(4.00),5.00 (5.25),2.50(5.00),2.50(4.75),2.00 (6.00) for pre-treatment,one week,one month,two months,and three months,respectively.Such variances of NRS ratings were statistically significant (Z=-2.773,-2.740,-2.769,-2.675;P＜0.05).The BPI-QOL ratings were (42.42± 8.27),(30.67 ± 12.29),(29.17±15.38),(29.92± 17.67) and (35.67± 19.28),respectively.The BPI-QOL ratings decreased in the first two months after the treatment which is statistically significant (t=3.231,2.820 and 2.453;P＜0.05);whereas for the third month,the BPI-QOL rating was statistically insignificant compared with the one before the treatment (P＞0.05).The KPS ratings were 80(28),80(20),65(45) for pre-treatment,one week and three months after treatment,respectively.Three months after the treatment,the KPS ratings decreased which was statistically significant compared with the one before the treatment (Z=-2.204,P＜0.05).After the treatment,one patient developed deep venous thrombosis,three patients reported lower extremities numbness,two patients had soft tissue edema around the lesions.Conclusions MRgFUS is effective for short-term pain palliation of bone metastases.Such noninvasive technique is safe and can improve patients' living condition.

OBJECTIVE: To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism. METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis. RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin. CONCLUSION The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Autistic Disorder/genetics* ; Child ; Developmental Disabilities ; Female ; Humans ; Mutation ; Retrospective Studies ; Syndrome ; Transcription Factors/genetics*

Endovascular treatment is a standard treatment regimen for patients with acute ischemic stroke caused by large vessel occlusion. The anesthetic strategy for patients with acute ischemic stroke undergoing endovascular treatment includes local anesthesia, conscious sedation, and general anesthesia. However, the optimal anesthetic strategy for patients with acute ischemic stroke undergoing endovascular treatment is controversial.

OBJECTIVEUsing European five-dimensional health questionnaire (EQ-5D) to study the quality of life among the population over 60 years old in Dalian city and analyze the influence factors.

METHODIn 2013, multi-stage stratified cluster random sampling method and EQ-5D questionnaire were used to investigate the status of 4 081 participants over the age of 60 in Dalian. The questionnaire contained EQ-5D health describing system and the VAS. The EQ-5D index and EQ-VAS score of the study objects were calculated and the participants' quality of life and impact factors were analyzed.

RESULTWomen's percentage of "having difficulty" in 5 dimensionalities was 18.1% (373/2 059), 12.6% (264/2 059), 16.2% (334/2 059), 32.0% (659/2 059), 17.5% (371/2 059) respectively, men' percentage of "having difficulty" in 5 dimensionalities was 13.3% (269/2 022), 10.2% (218/2 022), 12.5% (253/2 022), 23.1% (467/2 022), 13.7% (77/2 022) respectively, and the difference was significant (P < 0.05). The EQ-5D index and VAS score of men was (0.82 ± 0.30), (72.75 ± 16.26), higher than those of women ( (0.79 ± 0.33), (70.79 ± 16.64 )) and the difference was significant (P < 0.05). The score of quality of life who were married was (0.82 ± 0.28) and (73.27 ± 16.60).With age increasing, the elders' quality of life score decreased, and with education level increasing, the elders' quality of life score increased (P < 0.05).

CONCLUSIONThe quality of life of the elders in Dalian city was kind of good, and it could be impacted by genders, marital status, education levels and the chronic diseases.

Age Factors ; China ; epidemiology ; Cities ; Education ; Female ; Health ; Humans ; Male ; Quality of Life ; Sex Factors ; Surveys and Questionnaires