1.EXPERIMENTAL STUDY ON THE EFFECT OF REMIFENTANIL ON THE EXPRESSION OF ADHENSIVE FACTORS IN LUNG INJURY IN RATS
Medical Journal of Chinese People's Liberation Army 1981;0(06):-
To determine the effects of Remifentanil on the expression of adhesive factors during acute lung injury, we used immunohistochemistry and reverse transcription polymerase chain reaction (RT PCR) technics to measure the expression levels of ICAM 1, and P Selectin in the lung in a rat model of hemorrhagic shock. We duplicated modified Wigger hemorrhagic shock model in healthy SD rats. The rats were divided into three groups: control group, resuscitation group, resuscitation and drug using group. The positive ratios of ICAM 1 and P Selectin in the lungs at different time points, namely preshock, shock, resuscitation 2 hours, and resuscitation 4 hours were determined. There were 6 rats in each group and each time point. The degree of pulmonary injury in the drug using group was less than that in other two groups. Resuscitation with lactated Ringer's solution led to most serious injury in the resuscitation group. In drug using group, the expression of ICAM 1 and P Selectin was far less than that in the other two groups ( P
2.STUDY ON THE EFFECT OF REMIFENTANIL ON THE EXPRESSION OF APOPTOSIS FACTORS IN LUNG IN RATS WITH HEMORRHAGIC SHOCK
Medical Journal of Chinese People's Liberation Army 2001;0(10):-
Objective To determine the modulating effects of remifentanil on the expression of apoptosis factors during acute lung injury as a result of hemorrhagic shock, we observed the expression of C-Jun, Bax, Bcl-2 in lung with immunohistochemistry in rats with hemorrhagic shock. Methods Hemorrhagic shock model was replicated with modified Wigger's method in healthy SD rats. Seventy-two rats were randomized into three groups: sham resuscitation, resuscitation with lactated Ringer′s solution, and fluid resuscitation with remifentanil. Positive rates of C-Jun, Bax, Bcl-2 were assayed in the lungs at different time points: preshock, shock, 2 hours after resuscitation, and 4 hours after resuscitation. Results ①The model of acute lung injury subsequent to hemorrhagic shock was reproduced in rats. ②The expression of Bcl-2 elevated slowly in three groups, while the expression of Bax elevated rapidly, and there were significant differences between the value of baseline and those of other time points (P
4. Expressions of heparanase and CD44v6 in osteosarcoma tissues and their correlations
Tumor 2007;27(10):817-820
Objective: To study the expression of heparanase and CD44v6 in osteosarcoma and analyze the correlation between them. Methods: The expressions of heparanase and CD44v6 in human osteosarcoma were detected by immunohistochemical staining. Results: The positive rates of heparanase and CD44v6 protein in osteosarcoma tissues were significantly higher in osteosarcoma tissues than in osteochondroma (79.6% vs 20.0% and 55.1% vs 25.0%, P < O. 05). Expressions of heparanase and CD44v6 had positive correlation (r=0.663, P < 0.001). Both of them were closely associated with clinical stage and metastasis of osteosarcoma. Conclusion: Overexpressions of heparanase and CD44v6 in human osteosarcoma may stimulate the adhesion, invasion, and metastasis of osteosarcoma.
6.Experimental and Clinical Study on Detection of Medically Important Fungi by PCR with A Universal Fungus-specific Primer System
Hong ZHANG ; Shaoxi WU ; Ningru GUO
Chinese Journal of Dermatology 1994;0(05):-
Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.
7.The influence of soft tissue release on the tension around hip joint through posterolateral hip approach
Ming LU ; Hong ZHANG ; Shengjie GUO
Chinese Journal of Orthopaedics 2009;29(3):252-256
ObjectiveTo investigate the influence of selective soft tissue release on the tension around hip joint through posterolateral approach, and to ascertain the sequence of soft tissue release in total hip arthroplasty. MethodsFive fresh frozen cadavers with ten intact lower extremities were used in the study. All the pelves of cadavers were fixed on the operating table by a special designed fixer on a lateral position. Femoral supracondylar bone traction was employed for axial traction. The force for traction was 15 kg. Posterolateral approach was used for exposure and two sequences for soft tissue release were studied. One Kirschner wire was fixed at the bone near the anterior superior iliac spine, and the wire was perpendicu-lar to the operating table. Another Kirschner wire was fixed into the bone at lateral femoral shaft. The two Kirschner wires were parallel to each other. The distance between the two Kirschner wires was measured be-fore and after each soft tissue structure release. ResultsThere were no significant changes of the distance measured before and after applying traction alone, releasing external rotation muscles, opening the posterior capsule and releasing the gluteus maximus insertion. There were significant changes of distance measured before and after resection of femoral head, release of tensor fasciae latae and/or iliotibial band, excision of anterior capsule, and release of iliopsoas tendon had. The average lengthened distance was 1.5 mm (range, 1-3 mm) after resection of femoral head, and 8.0 mm (range, 2-19 mm) after release of tensor fasciae latae and/or iliotibial band, 5.5 mm (range, 1-13 mm) after excision of anterior capsule, and 1.8 mm (range, 1-3 mm) after release of iliopsoas tendon respectively. The distance lengthened after both release of tensor fasci-ae latae (and/or iliotibial band) and excision of anterior capsule was the most significant, average 13.5 mm (range, 11-20 mm). ConclusionRelease of anterior capsule, tensor fasciae latae and/or iliotibial band, and iliopsoas tendon will decrease the soft tissue tension around hip joint. Among all the soft tissue structures we investigated, the anterior capsule and tensor fasciae latae (iliotibial band) make the most effective result. To maintain the soft tissue tension around hip joint depends on different structures working together, releasing one structure alone may not obtain the optimal result. Careful evaluation of tension of tensor fasciae latae and iliotibial band can help avoiding the limb length discrepancy during hip arthroplasty surgery.
8.Bibliometric indicators of publications in oncology and papers of chinese authors
Yuhua ZHANG ; Hong GUO ; Yuntao PAN
Cancer Research and Clinic 2010;22(10):649-651
Comparing with the world level, the bibliometric indicators of Chinese medical journals in oncology field are rather lower, but our medical journals have big development space. In the world journals with high impact index, the papers published by Chinese authors are fewer; in the papers number, the superiority of Chinese authors is in tumor clinical therapy field. Most papers are written by researchers from large institutions with plenty of medical resources.
9.The inhibitory effect of capsaicin on streptozocin-induced apoptosis of rat retinal cells
Ting, ZHANG ; Ji-hong, YANG ; Zheng, GUO
Chinese Journal of Experimental Ophthalmology 2013;(1):34-38
Background Diabetes mellitus (DM) can provoke the apoptosis of retinal cells and downregulate the expression of calcitonin gene related peptide (CGRP) in the retina.Capsaicin promotes the release of CGRP and elicits protective effects on human organs.However,whether CGRP protects retinal cells in diabetic retinopathy (DR) is still unclear.Objective The study was designed to examine the effect of capsaicin on the apoptosis of retinal cells in diabetic rats and its relationship with CGRP.Methods Forty clean healthy adult male Sprague-Dawey rats were randomly divided into the diabetes group,capsaicin pretreated group,streptozocin (STZ)control group,capsaicin control group and plain control group,with 8 rats per group.The diabetic model was established by the intraperitoneal injection of 60 mg/kg in all rats except those of the plain control group.0.4 mL of a 1% capsaicin injected at 20 mg/kg was subcutaneously injected for 3 consecutive days prior to model establishment in the capsaicin pretreated group,after which 1.2 mL of STZ was intraperitoneally injected on the fourth day.Rats from the STZ control group were administered intraperitoneally 1.2 mL of 0.1 mol/L,pH 4.5,citrate buffer.The capsaicin control group received subcutaneous injections of 0.4 mL of 1% capsaicin at 20 mg/kg for 3 consecutive days,after which 1.2 mL of 0.1 mol/L,pH 4.5,citrate buffer was administered intraperitoneally.The rats were sacrificed at the tenth week after model establishment and retinal specimens were prepared for the apoptosis assay by TUNEL staining and the quantitative analysis of caspase-3 activity.Expression of CGRP in the retina and serum was detected using ELISA.The use of experimental animals followed the Regulations for the Administration of Affairs Concerning Experimental Animals by State Science and Technology Commission.Results Retinal cell apoptosis was mainly localized to the retinal ganglion cell (RGC) layer.The apoptosis rate of RGCs was (43.4±5.0)% in the DR model group and (30.0±5.1)% in the capsaicin pretreated group,showing a significant difference (t =5.930,P<0.01).Compared with the DR model group and capsaicin pretreated group,the apoptosis rates of the DR control group (12.4±9.9) % and the capsaicin control group (17.6-±6.1) % were significantly lower (t =8.800,t =4.925,P<0.01).The apoptosis rate of the plain control group was (16.2±6.9)%,exhibiting significant differences in comparison with the DR control group and capsaicin control group (t =-0.989,t =0.951,P>0.05).The specific activity of caspase-3 was (2.19±0.86) in the DR model group and (1.96±0.56) in the capsaicin pretreated group,presenting a significant difference (t =-0.515,P<0.05).Those of the DR control group and capsaicin control group were (1.47±0.14) and (0.74±0.27),respectively,with considerable decline in comparison with the DR model group and capsaicin pretreated group (t=2.142,t=2.797,P<0.05).The retinal and serum CGRP levels were (424.4±44.2)and (148.8±39.1) ng/L,respectively,displaying significantly lower levels than (543.2±74.4) and (237.5±78.7) ng/L (t =3.070,2.359,P<0.05) from the capsaicin pretreated group.Conclusions Apoptosis of retinal ganglion cells occurs in the STZ-induced diabetic rats.Pretreatment of capsaicin reduces retinal cell apoptosis,which may be associated with an increase of CGRP in the retina.
10.Effect of glial-derived neurotrophic factor on proliferation and migration of adenoid cystic carcinoma cell in vitro
Lin, LIU ; Guo-xiang, SONG ; Hong, ZHANG
Chinese Journal of Experimental Ophthalmology 2013;(3):243-247
Background Perineural invasion is an important biological character for adenoid cystic carcinoma (ACC) of lacrimal gland,which is different from those of other lacrimal gland tumors.As the important part of neurotrophic factors,glial-derived neurotrophic factor (GDNF) plays an important role in perineural invasion for ACC of salivary gland.GDNF regulation in the ACC cell biology function needs to be further explored.Objective This study was to investigate the effect of GDNF on proliferation and migration of ACC cells,and to explore the mechanism of neural invasion in ACC of lacrimal gland.Methods ACC-2 cell line was cultured and passaged in RPMI 1640 medium with 10% fetal bovine serum,100 U/ml penicillin and 0.1 g/L streptomycin.Single-cell suspension was prepared with the density of 2×104/ml using logarithmic phase of cells and then incubated to 96-well plate.GDNF with the final concentration of 20,60,80,100 and 120 μg/L was added into the medium respectively in the experimental groups,and the cells were cultured in the medium without GDNF as the control group.The expression of GDNF in ACC-2 cells was detected by immunohistochemistry.MTT assay was employed to assay the absorbance value at the wavelength of 570 nm (A570) for the evaluation of proliferation of ACC-2 cells after cultured by different concentrations of GDNF for different time points.Meanwhile,transwell chamber was used to examine the cell migrated number.Results Immunochemistry assay exhibited that ACC-2 cells showed the positive response for GDNF with the brown staining in the cytoplasm.In 48 hours after culture,the A570 value was elevated with the increase of GDNF concentration,showing a significant difference among various groups (F =3.336,P =0.026),and the A570 value in various concentrations of GDNF groups was higher than that of 0 μg/L GDNF group (all P<0.05).After action of 80 μg/L GDNF,the A570 value of the cells was gradually increased with the prolong of culture time (Ftime =39.979,P=0.000).In 30 minutes after GDNF cultured,the number of migrated cells increased with the increase of GDNF concentration (F=144.886,P=0.000).ACC-2 cells were cultured by 100 μg/L GDNF for 24,30 and 40 hours,the number of migrated cells were more as the time lapse,and more migrated cells were seen in GDNF group at various time points (Ftime =46.747,P =0.000 ; Fgroup =63.786,P =0.000).Conclusions GDNF can stimulate the proliferation and migration of ACC-2 cells in a dose-and time-dependent manner.