3.Experimental and Clinical Study on Detection of Medically Important Fungi by PCR with A Universal Fungus-specific Primer System
Hong ZHANG ; Shaoxi WU ; Ningru GUO
Chinese Journal of Dermatology 1994;0(05):-
Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.
5.Effect of Alisol Monoacetate A and B on Metabolism of Cholesterol in HepG2 Cell Line
Shuisheng WU ; Gaige GUO ; Hong SHI ; Hong WANG ; Lee DAVID
China Journal of Traditional Chinese Medicine and Pharmacy 2005;0(07):-
Objective:To probe the effect of Alisol Monoacetate A and Alisol Monoacetate B on the synthesis and metabolism of cholesterol in HepG2 cell line.Methods:Controlled with Lipitor,different concentration of Alisol Monoacetate A and B were added to HepG2 cell line model,then collected and detected the contents of cholesterol in the cell lysate and cultured medium after 24h's cultivation.Results:The cytotoxicity of Alisol Monoacetate A and B appeared at least 10% when its concentration was higher than 10?M,more than 70% when its concentration was 50?M.The contents of cholesterol in HepG2 cell lysate increased from 24.4,26.7,32.3 and 38.3?g/mg protein corresponding with the concentration of 0?M,3?M,10?M and 20?M respectively,which showed the positive dose-effect relationship.However,the contents of cholesterol in the cultured medium manifested no difference.Conclusion:Alisol Monoacetate A and B could enhance the metabolic activity of mitochondria and increase the synthesis of cholesterol in HepG2 cell line.
6.Mechanism of the dentino-enamel junction on the resist-crack propagation of human teeth by the finite element method.
Jingjing ZHENG ; Tiezhou HOU ; Hong TAO ; Xueyan GUO ; Cui WU
West China Journal of Stomatology 2014;32(5):464-466
OBJECTIVEThis study aims to identify the crack tip stress intensity factor of the propagation process, crack propagation path, and the changes in the shape of the crack tip by the finite element method.
METHODSThe finite element model of dentino-enamel junction was established with ANSYS software, and the length of the initial crack in the single edge was set to 0.1 mm. The lower end of the sample was fixed. The tensile load of 1 MPa with frequency of 5 Hz was applied to the upper end. The stress intensity factor, deflection angle, and changes in the shape of the crack tip in the crack propagation were calculated by ANSYS.
RESULTSThe stress intensity factor suddenly and continuously decreased in dentino-enamel junction as the crack extended. A large skewed angle appeared, and the stress on crack tip was reduced.
CONCLUSIONThe dentino-enamel junction on human teeth may resist crack propagation through stress reduction.
Dental Enamel ; Dentin ; Humans ; Stress, Mechanical ; Tooth Fractures
7.How to improve the Clinical teaching in respiratory medicine
Hong CHEN ; Tao JIANG ; Shuliang GUO ; Yamei WU
Chinese Journal of Medical Education Research 2006;0(09):-
In order to improve the Interns’ synthetic medical quality of respiratory medicine, based on the teaching practice of respiratory medicine in our hospital, the analysis of admission introduction and requests for high quality medical ability are reviewed in the present article.
8.Application of Scaffolds in Construction of Random Peptide Libraries and Targeted Molecules Selection
Hong-Guang GUO ; Hai-Jiang WU ; Can-Quan MAO ;
China Biotechnology 2006;0(09):-
Nature is abundant in protein scaffolds.By selecting suitable protein scaffold,display and screening methods,the rational and constrained random peptide library(RPL)can be constructed.Compared with the non-constrained RPL,it offered more opportunities for obtaining novel protein structures and more higher affinity ligands against the target molecules.At present,the protein scaffold constrained RPLs have been shown great potential in applications such as target selection,basic research,clinical diagnosis,medical therapy and so on.It is systematically introduced the structure bases,classification and construction of constrained RPL based on scaffolds,as well the recent great advances of application in selection against target molecules with S-S constrained scaffolds,antibodies,Zinc finger protein,Z domain,FN3 domain as important examples.
9.Effects of dexmedetomidine on global cerebral ischemia-reperfusion injury in rats
Peipei GUO ; Hong YAN ; Shiying YUAN ; Huisheng WU ; Jingli CHEN
Chinese Journal of Anesthesiology 2011;31(10):1264-1267
Objective To investigate the effects of dexmedetomidine on global cerebral ischemia-reperfusion (I/R) injury in rats.Methods Fifty-four adult male SD rats weighing 200-250 g were randomly divided into 3 groups (n =18 each): shame operation group (group S),global cerebral I/R group (group I/R) and dexmedetomidine group (group D).Global cerebral I/R was produced by occlusion of bilateral common carotid arteries combined with hypotension (MAP maintained at 35-45 mm Hg).In group D dexmedetomidine 3 μg/kg was injected iv immediately after I/R,followed by infusion of dexmedetomidine at a rate of 3 μg· kg- 1 · h- 1 until 2 h of reperfusion.The neurological deficit score (NDS) was assessed (0 =normal,100 =brain death) at 6 h (T1),24 h (T2)and 72 h (T3) of reperfusion.Then six rats were sacrificed in each group and brain tissues were removed for microscopic examination of hippocampus CA1 region and determination of activity of myeloperoxidase (MPO),contents of TNF-α and IL-1β and expression of glial fibrillary acidic protein ( GFAP).Results Compared with group S,NDS,MPO activity and the contents of TNF-α and IL-1β at T1-3 were significantly increased,the expression of GFAP was up-regulated at T2,3 in groups I/R and D ( P < 0.05 or 0.01).Compared with group I/R,NDS,MPO activity and TNF-α concent were significantly decreased at T1-3,IL-1β concent was decreased at T1,2,the expression of GFAP was down-regulated at T2,3 in group D (P < 0.05 or 0.01 ).The pathologic changes were significantly attenuated in group D as compared with group I/R.Conclusion Dexmedetomidine can attenuate global cerebral I/R injury in rats,and the inhibition of inflammatory response may be involved in the mechanism.
10.Diagnosis and microsurgery of acute spontaneous spinal epidural hematoma
Wusi QIU ; Zhenghu WU ; Chenchen GUO ; Hong SHEN ; Weiguo LIU
Chinese Journal of Postgraduates of Medicine 2009;32(17):12-14
Objective To investigate the diagnosis and the effect of microsurgery in patients with acute spontaneous spinal epidural hematoma (ASSEH). Method Five patients with ASSEH treated with microsurgery and confirmed pathologically were retrospectively analyzed. Results The main clinical presentations were root pain and palsy. The main manifestations of MRI were long-segment epidural lesion of high intensity in T1 and T2-weighted images without enhancement. With the microsurgery system, laminectomy via posterior approach and hematoma removal were successfully undergone with full recovery in all cases. Conclusions MRI assisted with the main clinical symptoms may aid preoperative diagnosis in symptomatic ASSEH. Microsurgery is an effective method for treating ASSEH. Postoperative (rather than preoperative) spinal DSA is advantageous for exclusion of spinal vascular malformation in treating ASSEH.