Aortopulmonary Septal Defect ; therapy ; Catheterization ; Female ; Humans ; Infant

Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.

Adult ; Female ; Health Knowledge, Attitudes, Practice ; Health Promotion ; Humans ; Lead ; Male ; Middle Aged ; Occupational Exposure ; prevention & control ; Occupational Health ; Occupational Health Services ; Stearates ; Young Adult

Objective:To probe the effect of Alisol Monoacetate A and Alisol Monoacetate B on the synthesis and metabolism of cholesterol in HepG2 cell line.Methods:Controlled with Lipitor,different concentration of Alisol Monoacetate A and B were added to HepG2 cell line model,then collected and detected the contents of cholesterol in the cell lysate and cultured medium after 24h's cultivation.Results:The cytotoxicity of Alisol Monoacetate A and B appeared at least 10% when its concentration was higher than 10?M,more than 70% when its concentration was 50?M.The contents of cholesterol in HepG2 cell lysate increased from 24.4,26.7,32.3 and 38.3?g/mg protein corresponding with the concentration of 0?M,3?M,10?M and 20?M respectively,which showed the positive dose-effect relationship.However,the contents of cholesterol in the cultured medium manifested no difference.Conclusion:Alisol Monoacetate A and B could enhance the metabolic activity of mitochondria and increase the synthesis of cholesterol in HepG2 cell line.

Adult ; Genotype ; Humans ; Male ; Middle Aged ; Peptidyl-Dipeptidase A ; blood ; genetics ; Pneumoconiosis ; blood ; genetics ; Polymorphism, Single Nucleotide

ADP-ribosyl Cyclase 1 ; immunology ; Biopsy ; Bone Marrow ; immunology ; pathology ; Epoxy Resins ; Humans ; Immunohistochemistry ; Ki-67 Antigen ; immunology ; Plastic Embedding ; Staining and Labeling ; methods

The status of acupuncture-moxibustion is more and more recognized by mainstream medicine in the world in recent years, and literature regarding acupuncture-moxibustion with high impact factor (IF) published in the worldwide mainstream medicine journals is also gradually growing by years. To understand the situation of related literature, literature regarding acupuncture-moxibustion with IF of more than 10 in Science Citation Index (SCI) during the recent 5 years was retrieved. The number, the types, the diseases involved, the publishing states of the acquired articles and the source, the citation, the IF of the publishing journals were analyzed and summarized. Additionally, some of the research foci, the new research tendencies and the deficiencies of research were discussed. The thoughts and suggestions are expected to be provided for further research of acupuncture.
Acupuncture Therapy ; statistics & numerical data ; Bibliometrics ; Humans ; Journal Impact Factor ; Moxibustion ; statistics & numerical data ; Publications ; statistics & numerical data

Objective To evaluate the effects of dexmedetomidine on the permeability of blood-brain barrier in rats subjected to global cerebral ischemia-reperfusion (I/R).Methods Thirty-six male Sprague-Dawley rats,weighing 250-300 g,were randomly divided into 3 groups (n =12 each):sham operation group (group S),global cerebral I/R group (group I/R) and dexmedetomidine group (group D).Global cerebral I/R was induced by occlusion of bilateral common carotid arteries combined with hypotension (MAP was maintained at 35-45 mm Hg) in anesthetized rats.In group D,dexmedetomidine was infused at a rate of 3μg· kg-1 · h-1 until 2 h of reperfusion after a loading dose of dexmedetomidine 3 μg/kg was injected intravenously immediately after onset of I/R.The rats were sacrificed at 24 h of reperfusion and their brains were immediately removed for microscopic examination of hippocampal CA1 region and for determination of the cell apoptosis,brain water content,Evans blue content and aquaporin 4 (AQP4) expression.Results The number of apoptotic cells was significantly larger,and brain water content,Evans blue content and AQP4 expression were higher in groups I/R and D than in group S (P ＜ 0.05 or 0.01).The number of apoptotic cells was significantly smaller,and brain water content,and Evans blue content and AQP4 expression were lower in group D than in group I/R (P ＜ 0.05 or 0.01).Global cerebral I/R-induced pathological changes were significantly attenuated in group D.Conclusion Dexmedetomidine can decrease the permeability of blood-brain barrier and attenuate global cerebral I/R injury in rats,and down-regulation of AQP4 expression may be involved in the mechanism.

Objective To evaluate the effects of dexmedetomidine on the oxidative stress responses during global cerebral ischemia-reperfusion (I/R) in rats.Methods Thirty-six male Sprague-Dawley rats,weighing 250-300 g,were randomly divided into 3 groups (n =12 each) using a random number table:sham operation group (group S),global cerebral I/R group (group I/R) and dexmedetomidine group (group D).Global cerebral ischemia was induced by occlusion of bilateral common carotid arteries combined with hypotension (MAP maintained at 35-45 mmHg).In group D,dexmedetomidine was infused at a rate of 3 μg · kg-1 · h-1until 2 h of reperfusion after a loading dose of dexmedetomidine 3 μg/kg was intravenously injected immediately after onset of reperfusion.The neurological deficit score (NDS) was assessed at 24 h of reperfusion,the rats were then sacrificed,and their brains were immediately removed for determination of cell apoptosis and levels of malondialdehyde (MDA),superoxide dismutase (SOD) and catalase (CAT).Apoptotic rate was calculated.Results Compared with group S,NDS,apoptotic rate and MDA level were significantly increased,and SOD and CAT levels were decreased in I/R and D groups.Compared with group I/R,NDS,apoptotic rate and MDA level were significantly decreased,and SOD and CAT levels were increased in group D.Conclusion Dexmedetomidine attenuates global cerebral I/R injury through inhibiting the oxidative stress responses.