Aortopulmonary Septal Defect ; therapy ; Catheterization ; Female ; Humans ; Infant

Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.

Adult ; Female ; Health Knowledge, Attitudes, Practice ; Health Promotion ; Humans ; Lead ; Male ; Middle Aged ; Occupational Exposure ; prevention & control ; Occupational Health ; Occupational Health Services ; Stearates ; Young Adult

Objective:To probe the effect of Alisol Monoacetate A and Alisol Monoacetate B on the synthesis and metabolism of cholesterol in HepG2 cell line.Methods:Controlled with Lipitor,different concentration of Alisol Monoacetate A and B were added to HepG2 cell line model,then collected and detected the contents of cholesterol in the cell lysate and cultured medium after 24h's cultivation.Results:The cytotoxicity of Alisol Monoacetate A and B appeared at least 10% when its concentration was higher than 10?M,more than 70% when its concentration was 50?M.The contents of cholesterol in HepG2 cell lysate increased from 24.4,26.7,32.3 and 38.3?g/mg protein corresponding with the concentration of 0?M,3?M,10?M and 20?M respectively,which showed the positive dose-effect relationship.However,the contents of cholesterol in the cultured medium manifested no difference.Conclusion:Alisol Monoacetate A and B could enhance the metabolic activity of mitochondria and increase the synthesis of cholesterol in HepG2 cell line.

Objective To investigate the diagnosis and the effect of microsurgery in patients with acute spontaneous spinal epidural hematoma (ASSEH). Method Five patients with ASSEH treated with microsurgery and confirmed pathologically were retrospectively analyzed. Results The main clinical presentations were root pain and palsy. The main manifestations of MRI were long-segment epidural lesion of high intensity in T1 and T2-weighted images without enhancement. With the microsurgery system, laminectomy via posterior approach and hematoma removal were successfully undergone with full recovery in all cases. Conclusions MRI assisted with the main clinical symptoms may aid preoperative diagnosis in symptomatic ASSEH. Microsurgery is an effective method for treating ASSEH. Postoperative (rather than preoperative) spinal DSA is advantageous for exclusion of spinal vascular malformation in treating ASSEH.

Child ; Collagen Type IV ; Female ; Humans ; Immunohistochemistry ; methods ; Kidney ; pathology ; Male ; Nephritis, Hereditary ; diagnosis ; pathology

ADP-ribosyl Cyclase 1 ; immunology ; Biopsy ; Bone Marrow ; immunology ; pathology ; Epoxy Resins ; Humans ; Immunohistochemistry ; Ki-67 Antigen ; immunology ; Plastic Embedding ; Staining and Labeling ; methods

Adult ; Genotype ; Humans ; Male ; Middle Aged ; Peptidyl-Dipeptidase A ; blood ; genetics ; Pneumoconiosis ; blood ; genetics ; Polymorphism, Single Nucleotide

The status of acupuncture-moxibustion is more and more recognized by mainstream medicine in the world in recent years, and literature regarding acupuncture-moxibustion with high impact factor (IF) published in the worldwide mainstream medicine journals is also gradually growing by years. To understand the situation of related literature, literature regarding acupuncture-moxibustion with IF of more than 10 in Science Citation Index (SCI) during the recent 5 years was retrieved. The number, the types, the diseases involved, the publishing states of the acquired articles and the source, the citation, the IF of the publishing journals were analyzed and summarized. Additionally, some of the research foci, the new research tendencies and the deficiencies of research were discussed. The thoughts and suggestions are expected to be provided for further research of acupuncture.
Acupuncture Therapy ; statistics & numerical data ; Bibliometrics ; Humans ; Journal Impact Factor ; Moxibustion ; statistics & numerical data ; Publications ; statistics & numerical data