Aortopulmonary Septal Defect ; therapy ; Catheterization ; Female ; Humans ; Infant

Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.

Adult ; Female ; Health Knowledge, Attitudes, Practice ; Health Promotion ; Humans ; Lead ; Male ; Middle Aged ; Occupational Exposure ; prevention & control ; Occupational Health ; Occupational Health Services ; Stearates ; Young Adult

Objective:To probe the effect of Alisol Monoacetate A and Alisol Monoacetate B on the synthesis and metabolism of cholesterol in HepG2 cell line.Methods:Controlled with Lipitor,different concentration of Alisol Monoacetate A and B were added to HepG2 cell line model,then collected and detected the contents of cholesterol in the cell lysate and cultured medium after 24h's cultivation.Results:The cytotoxicity of Alisol Monoacetate A and B appeared at least 10% when its concentration was higher than 10?M,more than 70% when its concentration was 50?M.The contents of cholesterol in HepG2 cell lysate increased from 24.4,26.7,32.3 and 38.3?g/mg protein corresponding with the concentration of 0?M,3?M,10?M and 20?M respectively,which showed the positive dose-effect relationship.However,the contents of cholesterol in the cultured medium manifested no difference.Conclusion:Alisol Monoacetate A and B could enhance the metabolic activity of mitochondria and increase the synthesis of cholesterol in HepG2 cell line.

OBJECTIVEThis study aims to identify the crack tip stress intensity factor of the propagation process, crack propagation path, and the changes in the shape of the crack tip by the finite element method.

METHODSThe finite element model of dentino-enamel junction was established with ANSYS software, and the length of the initial crack in the single edge was set to 0.1 mm. The lower end of the sample was fixed. The tensile load of 1 MPa with frequency of 5 Hz was applied to the upper end. The stress intensity factor, deflection angle, and changes in the shape of the crack tip in the crack propagation were calculated by ANSYS.

RESULTSThe stress intensity factor suddenly and continuously decreased in dentino-enamel junction as the crack extended. A large skewed angle appeared, and the stress on crack tip was reduced.

CONCLUSIONThe dentino-enamel junction on human teeth may resist crack propagation through stress reduction.

Adult ; Bronchoalveolar Lavage ; nursing ; Female ; Humans ; Male ; Middle Aged ; Pneumoconiosis ; nursing ; therapy ; Retrospective Studies

Objective To investigate the value of vessel size index(VSI) in grading oligodendroglioma by vessel size imaging technique. Methods Twenty-four histologically confirmed oligodendroglioma cases were enrolled (13 gradeⅡand 11 gradeⅢ) . All patients underwent conventional MRI scanning, followed by multi gradient-echo spin-echo sequence from dynamic susceptibility contrast perfusion to generate VSI maps. Region of interests were contoured on VSI color maps to obtain hot-spot value of mean VSI of microvasculature (VSImean) and maximum VSI of microvasculature (VSImax). Paraffin sections of each case was stained with CD34 to acquire microvascular caliber (VShis). Pearson correlation analysis was used to evaluate the correlation between VSImean, VSImax and VShis respectively. Mann-Whitney U test was used to compare VSImean, VSImax and VShis between grade Ⅱ and Ⅲ oligodendrogliomas. ROC analysis was performed to assess the effectiveness of VSImean, VSImax and VShis in grading oligodendrogliomas. Results Both VSImean and VSImax were strongly correlated with VShis (r=0.738, 0.705,P<0.05). For gradeⅡand Ⅲ oligodendrogliomas, VSImean were 38.93(17.96 to 81.18)μm and 91.49(36.94 to 144.68)μm, VSImax were 45.12(22.30 to 89.65)μm and 121.19(57.29 to 164.00)μm, VShis were 8.51(5.25 to 12.76)μm and 11.03(7.59 to 21.96)μm respectively. VSImean, VSImax, and VShis showed significant difference (Z=-3.505,-3.911, -2.729,P<0.05) between grade Ⅱ and Ⅲ oligodendrogliomas. ROC analysis revealed that the optimal cutoff value, sensitivity, specificity and AUC of VSImean was 52.58 μm, 90.91%, 92.31%, 0.923 respectively, 81.18μm, 90.91%, 100.00%, 0.972 for VSImax, and 9.01μm, 90.00%, 84.62%, 0.838 for VShis respectively. Conclusions Vessel size imaging derived VSI correlated well with histopathology. It could provide valuable information in the pre-operative grading of oligodendroglioma.

Objective To evaluate the effects of dexmedetomidine on the permeability of blood-brain barrier in rats subjected to global cerebral ischemia-reperfusion (I/R).Methods Thirty-six male Sprague-Dawley rats,weighing 250-300 g,were randomly divided into 3 groups (n =12 each):sham operation group (group S),global cerebral I/R group (group I/R) and dexmedetomidine group (group D).Global cerebral I/R was induced by occlusion of bilateral common carotid arteries combined with hypotension (MAP was maintained at 35-45 mm Hg) in anesthetized rats.In group D,dexmedetomidine was infused at a rate of 3μg· kg-1 · h-1 until 2 h of reperfusion after a loading dose of dexmedetomidine 3 μg/kg was injected intravenously immediately after onset of I/R.The rats were sacrificed at 24 h of reperfusion and their brains were immediately removed for microscopic examination of hippocampal CA1 region and for determination of the cell apoptosis,brain water content,Evans blue content and aquaporin 4 (AQP4) expression.Results The number of apoptotic cells was significantly larger,and brain water content,Evans blue content and AQP4 expression were higher in groups I/R and D than in group S (P ＜ 0.05 or 0.01).The number of apoptotic cells was significantly smaller,and brain water content,and Evans blue content and AQP4 expression were lower in group D than in group I/R (P ＜ 0.05 or 0.01).Global cerebral I/R-induced pathological changes were significantly attenuated in group D.Conclusion Dexmedetomidine can decrease the permeability of blood-brain barrier and attenuate global cerebral I/R injury in rats,and down-regulation of AQP4 expression may be involved in the mechanism.