1.EXPERIMENTAL STUDY ON THE EFFECT OF REMIFENTANIL ON THE EXPRESSION OF ADHENSIVE FACTORS IN LUNG INJURY IN RATS
Medical Journal of Chinese People's Liberation Army 1981;0(06):-
To determine the effects of Remifentanil on the expression of adhesive factors during acute lung injury, we used immunohistochemistry and reverse transcription polymerase chain reaction (RT PCR) technics to measure the expression levels of ICAM 1, and P Selectin in the lung in a rat model of hemorrhagic shock. We duplicated modified Wigger hemorrhagic shock model in healthy SD rats. The rats were divided into three groups: control group, resuscitation group, resuscitation and drug using group. The positive ratios of ICAM 1 and P Selectin in the lungs at different time points, namely preshock, shock, resuscitation 2 hours, and resuscitation 4 hours were determined. There were 6 rats in each group and each time point. The degree of pulmonary injury in the drug using group was less than that in other two groups. Resuscitation with lactated Ringer's solution led to most serious injury in the resuscitation group. In drug using group, the expression of ICAM 1 and P Selectin was far less than that in the other two groups ( P
2.STUDY ON THE EFFECT OF REMIFENTANIL ON THE EXPRESSION OF APOPTOSIS FACTORS IN LUNG IN RATS WITH HEMORRHAGIC SHOCK
Medical Journal of Chinese People's Liberation Army 2001;0(10):-
Objective To determine the modulating effects of remifentanil on the expression of apoptosis factors during acute lung injury as a result of hemorrhagic shock, we observed the expression of C-Jun, Bax, Bcl-2 in lung with immunohistochemistry in rats with hemorrhagic shock. Methods Hemorrhagic shock model was replicated with modified Wigger's method in healthy SD rats. Seventy-two rats were randomized into three groups: sham resuscitation, resuscitation with lactated Ringer′s solution, and fluid resuscitation with remifentanil. Positive rates of C-Jun, Bax, Bcl-2 were assayed in the lungs at different time points: preshock, shock, 2 hours after resuscitation, and 4 hours after resuscitation. Results ①The model of acute lung injury subsequent to hemorrhagic shock was reproduced in rats. ②The expression of Bcl-2 elevated slowly in three groups, while the expression of Bax elevated rapidly, and there were significant differences between the value of baseline and those of other time points (P
4. Expressions of heparanase and CD44v6 in osteosarcoma tissues and their correlations
Tumor 2007;27(10):817-820
Objective: To study the expression of heparanase and CD44v6 in osteosarcoma and analyze the correlation between them. Methods: The expressions of heparanase and CD44v6 in human osteosarcoma were detected by immunohistochemical staining. Results: The positive rates of heparanase and CD44v6 protein in osteosarcoma tissues were significantly higher in osteosarcoma tissues than in osteochondroma (79.6% vs 20.0% and 55.1% vs 25.0%, P < O. 05). Expressions of heparanase and CD44v6 had positive correlation (r=0.663, P < 0.001). Both of them were closely associated with clinical stage and metastasis of osteosarcoma. Conclusion: Overexpressions of heparanase and CD44v6 in human osteosarcoma may stimulate the adhesion, invasion, and metastasis of osteosarcoma.
5.Efficacy and safety of linezolid in the treatment of gram-positive coccus in-fection in the elderly
Ming HONG ; Kuanpeng GUO ; Lin ZHANG
Chinese Journal of Infection Control 2016;15(8):599-602
Objective To evaluate the efficacy and safety of linezolid in the treatment of gram-positive coccus in-fection in the elderly.Methods Clinical data of patients (>60 years old)infected with gram-positive coccus and treated with linezolid for 10 days between January 2013 and December 2014 were collected,the therapeutic efficacy of linezolid were analyzed,laboratory indexes before and 14 days after linezolid treatment were compared,possible adverse effects were analyzed.Results A total of 70 old patients were enrolled,the majority of patients were infec-ted in lower respiratory tract (62.86%)and were infected with Staphylococcus aureus (42.86%,of which 19 were MRSA),more than 80% of the patients were >70 years old,had length of stay > 30 days,and admitted in ICU, more than 70% of the patients were with deep venous catheterization and indwelling urinary catheterization.Platelet count (PLT)after 14 days of linezolid treatment was significantly lower than before treatment([132.00±45.00]× 109/L vs [156.00±78.00]×109/L,P =0.009);the total therapeutic efficacy of linezolid was 81 .43%(57/70), while the rate of adverse effects was 17.14% (12/70).Conclusion Linezolid is effective for treatment of gram-posi-tive coccus infection in the elderly,and may be a good choice of empirical treatment.PLT should be intensively mo-nitored during the process of linezolid therapy.
6.Experimental and Clinical Study on Detection of Medically Important Fungi by PCR with A Universal Fungus-specific Primer System
Hong ZHANG ; Shaoxi WU ; Ningru GUO
Chinese Journal of Dermatology 1994;0(05):-
Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.
7.Numerical Simulation of Heat Transfer in the Human Anterior Chamber at Different Corneal Temperatures.
Jingmin GUO ; Hong ZHANG ; Junming WANG
Journal of Biomedical Engineering 2015;32(6):1191-1195
A three-dimensional (3D) model of human anterior chamber is reconstructed to explore the effect of different corneal temperatures on the heat transfer in the chamber. Based on the optical coherence tomography imaging of the volunteers with normal anterior chamber, a 3D anterior chamber model was reconstructed by the method of UG parametric design. Numerical simulation of heat transfer and aqueous humor flow in the whole anterior chamber were analyzed by the finite volume methods at different corneal temperatures. The results showed that different corneal temperatures had obvious influence on the temperature distribution and the aqueous flow in the anterior chamber. The temperature distribution is linear and axial symmetrical around the pupillary axis. As the temperature difference increases, the symmetry becomes poorer. Aqueous floated along the warm side and sank along the cool side which forms a vortexing flow. Its velocity increased with the addition of temperature difference. Heat fluxes of cornea, lens and iris were mainly affected by the aqueous velocity. The higher the velocity, the bigger more absolute value of the above-mentioned heat fluxes became. It is practicable to perform the numerical simulation of anterior chamber by the optical coherence tomography imaging. The results are useful for studying the important effect of corneal temperature on the heat transfer and aqueous humor dynamics in the anterior chamber.
Anterior Chamber
;
physiology
;
Aqueous Humor
;
physiology
;
Cornea
;
physiology
;
Humans
;
Iris
;
Lens, Crystalline
;
Models, Biological
;
Temperature
;
Tomography, Optical Coherence
9.Bibliometric indicators of publications in oncology and papers of chinese authors
Yuhua ZHANG ; Hong GUO ; Yuntao PAN
Cancer Research and Clinic 2010;22(10):649-651
Comparing with the world level, the bibliometric indicators of Chinese medical journals in oncology field are rather lower, but our medical journals have big development space. In the world journals with high impact index, the papers published by Chinese authors are fewer; in the papers number, the superiority of Chinese authors is in tumor clinical therapy field. Most papers are written by researchers from large institutions with plenty of medical resources.
10.The influence of soft tissue release on the tension around hip joint through posterolateral hip approach
Ming LU ; Hong ZHANG ; Shengjie GUO
Chinese Journal of Orthopaedics 2009;29(3):252-256
ObjectiveTo investigate the influence of selective soft tissue release on the tension around hip joint through posterolateral approach, and to ascertain the sequence of soft tissue release in total hip arthroplasty. MethodsFive fresh frozen cadavers with ten intact lower extremities were used in the study. All the pelves of cadavers were fixed on the operating table by a special designed fixer on a lateral position. Femoral supracondylar bone traction was employed for axial traction. The force for traction was 15 kg. Posterolateral approach was used for exposure and two sequences for soft tissue release were studied. One Kirschner wire was fixed at the bone near the anterior superior iliac spine, and the wire was perpendicu-lar to the operating table. Another Kirschner wire was fixed into the bone at lateral femoral shaft. The two Kirschner wires were parallel to each other. The distance between the two Kirschner wires was measured be-fore and after each soft tissue structure release. ResultsThere were no significant changes of the distance measured before and after applying traction alone, releasing external rotation muscles, opening the posterior capsule and releasing the gluteus maximus insertion. There were significant changes of distance measured before and after resection of femoral head, release of tensor fasciae latae and/or iliotibial band, excision of anterior capsule, and release of iliopsoas tendon had. The average lengthened distance was 1.5 mm (range, 1-3 mm) after resection of femoral head, and 8.0 mm (range, 2-19 mm) after release of tensor fasciae latae and/or iliotibial band, 5.5 mm (range, 1-13 mm) after excision of anterior capsule, and 1.8 mm (range, 1-3 mm) after release of iliopsoas tendon respectively. The distance lengthened after both release of tensor fasci-ae latae (and/or iliotibial band) and excision of anterior capsule was the most significant, average 13.5 mm (range, 11-20 mm). ConclusionRelease of anterior capsule, tensor fasciae latae and/or iliotibial band, and iliopsoas tendon will decrease the soft tissue tension around hip joint. Among all the soft tissue structures we investigated, the anterior capsule and tensor fasciae latae (iliotibial band) make the most effective result. To maintain the soft tissue tension around hip joint depends on different structures working together, releasing one structure alone may not obtain the optimal result. Careful evaluation of tension of tensor fasciae latae and iliotibial band can help avoiding the limb length discrepancy during hip arthroplasty surgery.