Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

To analyze the current quality of treatment for hospitalized cancer patients in Beijing, identify major issues in treatment practices, and propose improvements.

Objective     To explore the timing and safety of limited-period lung cancer surgery in patients with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection. Methods     Clinical data of of patients infected with COVID-19 undergoing lung cancer surgery (an observation group) in the Department of Thoracic Surgery of Guangdong Provincial People's Hospital, the Department of Thoracic Surgery of General Hospital of Southern Theater Command of PLA, and the Department of Cardiothoracic Surgery of the First Affiliated Hospital of Guangdong Pharmaceutical University from December 2022 to January 2023 were retrospectively analyzed and compared with patients who underwent surgery during the same period but were not infected with COVID-19 (a control group), to explore the impact of COVID-19 infection on lung cancer surgery. Results     We finally included 110 patients with 73 patients in the observation group (28 males and 45 females at age of 52.62±12.80 years) and 37 patients in the control group (22 males and 15 females at age of 56.84±11.14 years). The average operation time of the observation group was longer than that of the control group, and the incidence of anhelation was higher than that of the control group (P<0.05). There were no statistcal differences in blood loss, length of hospital stay, moderate or above fever rate, degree of cough and chest pain, or blood routine between the two groups. Conclusion    It is safe and feasible to perform lung cancer surgery early after recovery for COVID-19 patients with lung cancer.

Objective    To explore the distribution pattern of respiratory symptoms and relevant factors in patients with pulmonary nodules. Methods    Demographic and clinical information were collected from patients who visited the Thoracic Surgery Outpatient Clinic of Guangdong Provincial People’s Hospital from January 2021 to January 2022. Hospital Anxiety and Depression Scale (HADS) was used to assess their anxiety and depression level. Results    A total of 1 173 patients were enrolled, including 449 males and 724 females, with an average age of 46.94±11.43 years. Among the patients with pulmonary nodules, 37.7% of them had at least one respiratory symptom; 24.4% had cough, 14.0% had expectoration, 1.3% had hemoptysis and 14.9% had chest pain. Old age, male, exposure to second-hand smoking or environmental smoke, hair coloring and history of tuberculosis were major risk factors for respiratory symptoms (P<0.05). Middle age, old age, male, exposure to environmental smoke were major risk factors for cough (P<0.05); old age, smoking, larger maximum nodules diameters, exposure to environmental smoke and history of pneumonia were major risk factors for expectoration (P<0.05); male, multiple nodules, hair coloring, exposure to second-hand smoking and history of tuberculosis were major risk factors for chest pain (P<0.05). Symptomatic patients showed generally higher HADS scores than asymptomatic patients (P<0.001). Conclusion    Cough, expectoration and chest pain are the predominant respiratory symptoms for patients with pulmonary nodules. The presentation of respiratory symptoms increases patients' anxiety and depression.

Objective     To identify the potential factors for psychological burdens and to better understand how the patients’ psychological status affect their treatment preferences. Methods     A questionnaire survey was conducted among 996 patients with pulmonary nodules who visited the Thoracic Surgery Clinic of Guangdong Provincial People's Hospital from January to November 2021, including 381 males and 615 females, aged 47.26±11.53 years. A self-administrated questionnaire was used to investigate the sociodemographic and clinical characteristics of the patients, and the Hospital Anxiety and Depression Scale (HADS) was used to evaluate the psychological status of the patients, with a score>7 points of each subscale indicating potential anxiety or depression. Results     Among the 996 patients with pulmonary nodules, the incidence of anxiety was 42.4% and the incidence of depression was 26.4%, while the incidence of both anxiety and depression was 24.7%. There was a significant correlation between anxiety and depression (ρ=0.834, P<0.05). Age, purpose of CT examination, number of pulmonary nodules and symptoms were independent factors for anxiety, while symptoms and number of pulmonary nodules were independent factors for depression (P<0.05). For treatment preferences, there was a statistical difference in educational level, symptoms, nodule size and anxiety level (P<0.05). Conclusion     Anxiety and depression are common in patients with pulmonary nodules. Symptoms are associated with anxiety and depression, which also make an impact on treatment preferences.

Chest trauma is one of the most common injuries. Venous thromboembolism (VTE) as a common complication of chest trauma seriously affects the quality of patients′ life and even leads to death. Although there are some consensus and guidelines on the prevention and treatment of VTE at home and abroad, the current literatures lack specificity considering the diagnosis, treatment and prevention of VTE in patients with chest trauma have their own characteristics, especially for those with blunt trauma. Accordingly, China Chest Injury Research Society and editorial board of Chinese Journal of Traumatology organized relevant domestic experts to jointly formulate the Chinese expert consensus on the diagnosis, treatment and prevention of chest trauma venous thromboembolism associated with chest trauma (2022 version). This consensus provides expert recommendations of different levels as academic guidance in terms of the characteristics, clinical manifestations, risk assessment, diagnosis, treatment, and prevention of chest trauma-related VTE, so as to offer a reference for clinical application.

Giant thoracic tumor is currently one of the diagnostic and therapeutic challenges of thoracic surgery, with no established guideline or standard for diagnosis and treatment. The quality control of individualized surgical strategy and perioperative management with multi-disciplinary participation is the key to ensure the safety and improve the prognosis of patients. Based on the clinical experience of our institution and others, we hereby discussed and summarized the basic principles, surgical strategies and perioperative management of giant thoracic tumor, aiming to provide a reference of quality control.

Objective To investigate the application value of enhanced recovery after surgery with no gastrointestinal decompression tube and with early postoperative oral feeding in minimally invasive radical resectionof esophageal cancer.Methods The retrospective cohort study was conducted.The clinicopathological data of 126 patients who underwent minimally invasive McKeown surgery in the General Hospital of Southern Theatre Command of PLA between March 2016 and October 2017 were collected.There were 80 males and 46 females,aged from 52 to 82 years,with an average age of 64 years.Of 126 patients,82 undergoing "li's anastomosis" with no gastrointestinal decompression tube and receiving early postoperative oral feeding were allocated into non-tube no fasting group,and 44 undergoing end-to-side gastroesophageal anastomosis with tubular stapler,conventionally indwelling gastrointestinal decompression tube,and beginning oral feeding at 1 week after surgery were allocated into traditional treatment group.Observation indicators:(1) surgical and postoperative recovery situations;(2) results of pathological examination;(3) follow-up.Follow-up using outpatient examination and telephone interview was performed to detect the postoperative tumor recurrence and metastasis up to October 2018.Measurement data with normal distribution were represented as Mean ± SD,and comparison between groups was analyzed using independent sample t test.Measurement data with skewed distribution were expressed as M (range),and comparison between groups was analyzed by rank sum test.Count data were described as absolute number or percentage,and comparison between groups was analyzed using chi-square test.Ordinal data were analyzed by rank sum test.Results (1) Surgical and postoperative recovery situations:patients in the two groups underwent minimally invasive McKeown surgery successfully.Operation time,volume of intraoperative blood loss,incidence of anastomotic fistula,incidence of pulmonary complications,and duration of postoperative hospital stay were respectively (326±41) minutes,(225±96) ml,7.3 ％ (6/82),24.4％ (20/82),and 10 days (range,6-90 days) in the non-tube no fasting group and (317± 37) minutes,(214 ± 66) mL,9.1％ (4/44),20.5％ (9/44),and 14 days (range,10-42 days) in the traditional treatment group;there was a statistically significant difference in duration of postoperative hospital stay between the two groups (Z =-7.129,P ＜ 0.05) and no statistically significant difference in operation time,volume of intraoperative blood loss,incidence of anastomotic fistula,and incidence of pulmonary complications between the two groups (t =1.311,0.703,x2 =0.000,0.077,P＞0.05).(2) Results of pathological examination:the number of lymph node dissected,cases in postoperative TNM stage Ⅰ,Ⅱ and Ⅲ were respectively 27±5,12,55,15 in the non-tube no fasting group and 26±5,9,28,7 in the traditional treatment group,with no statistically significant difference between the two groups (t =0.549,Z =-0.747,P＞0.05).(3) Follow-up:of 126 patients,116 were followed up for 12-31 months,with a median time of 20 months,including 76 in the non-tube no fasting group and 40 in the traditional treatment group.During the follow-up,no tumor recurrence or metastasis was found in the 116 patients.Conclusion The enhanced recovery after surgery with no gastrointestinal decompression tube and with early postoperative oral feeding is safe and feasible in the McKeown surgery,which can significantly shorten the postoperative hospitalization time compared with the traditional treatment.

Objective To evaluate economic benefits and clinical effects of internal fixation treatment of severe rib fracture so as to provide objective basis for improving medical treatment for rib fracture.Methods A retrospective review was made on clinical data of 50 patients with severe rib fracture hospitalized from January 2009 to April 2014.With varied treatment modalities,the patients were assigned to operative group (n =13) and non-operative group (n =37).Variables were recorded including length of stay,total hospital charges,length of ventilatory support,off-bed time,duration of antibiotic use and incidence of complications and used to perform cost-efficiency analysis.Results Between operative and non-operative groups,length of hospital stay was (25.9 ± 8.2) days vs (35.4 ± 7.0) days,total hospital charges were (121 676.2 ± 10 991.1) yuan vs (148 724.5 ± 21 254.3) yuan,length of ventilatory support was (7.9 ± 2.8) days vs (14.1 ± 3.3) days,off-bed time was (14.3 ± 4.9) days vs (26.1 ± 6.5) days,duration of antibiotic use was (12.4 ± 3.3) days vs (21.2 ± 6.2) days and complications occurred in 2 cases vs 13 cases respectively.The findings were length of ventilatory support,off-bed time and duration of antibiotic use differed significantly between the two groups (P ＜ 0.05).Cost-effectiveness ratios based on subjective and objective measures were superior in operative group (1 962.52 and 3 925.03) over those in non-operative group (1 931.48 and 3 718.10),suggesting operative treatment could yield higher economic returns.Conclusion Internal fixation can accelerate bone healing in patients with severer rib fracture and cut down medical expense,which should be promoted in medical treatment.

Objective To evaluate the efficacy and safety of minimally invasive percutaneous nephrolithotomy combined with negative pressure system in one-stage treatment of calculus pyonephrosis.Methods Eighty-three cases of calculus pyonephrosis,including 15 upper ureteral calculus cases,9 renal pelvis calculus cases,28 multiple calculus cases and 31 staghorn calculus cases,were retrospectively analysed.The diameter of the stone was from 1.2 to 6.3 cm.All the patients were punctured under X-ray or ultrasound guidance and established an access of 20 F.A 12 F nephroscope,combined with negative pressure system,was inserted to the collecting system to suck off the liquor pus.The stone was fragmented by pneumatic lithotripsy or holmium laser lithotripsy at one-stage.Negative pressure system was used to reduce the intrapelvic pressure during the operation.Results All the patients were treated successfully.The average operative time was 34 ± 19 min.The upper ureteral calculus and renal pelvis calculus cases were all stonefree at one-stage treatment.Of the other 59 cases,33 cases were stone-free and 26 cases need a secondlook.The total stone free rate was 68.7％(57/83)at one-stage and 91.6％(76/83)at second-look.Only 7 patients had fever after operation and no patient had sepsis or shock.Conclusion Combined with negative pressure system,minimally invasive percutaueous nephrolithotomy via a 20 F tract is safe and effective for one-stage treatment of calculus pyonephrosis.