1.Effect and economic analysis of operative treatment of severe rib fracture
Zhe HE ; Guibin QIAO ; Enwu XU
Chinese Journal of Trauma 2014;30(12):1201-1204
Objective To evaluate economic benefits and clinical effects of internal fixation treatment of severe rib fracture so as to provide objective basis for improving medical treatment for rib fracture.Methods A retrospective review was made on clinical data of 50 patients with severe rib fracture hospitalized from January 2009 to April 2014.With varied treatment modalities,the patients were assigned to operative group (n =13) and non-operative group (n =37).Variables were recorded including length of stay,total hospital charges,length of ventilatory support,off-bed time,duration of antibiotic use and incidence of complications and used to perform cost-efficiency analysis.Results Between operative and non-operative groups,length of hospital stay was (25.9 ± 8.2) days vs (35.4 ± 7.0) days,total hospital charges were (121 676.2 ± 10 991.1) yuan vs (148 724.5 ± 21 254.3) yuan,length of ventilatory support was (7.9 ± 2.8) days vs (14.1 ± 3.3) days,off-bed time was (14.3 ± 4.9) days vs (26.1 ± 6.5) days,duration of antibiotic use was (12.4 ± 3.3) days vs (21.2 ± 6.2) days and complications occurred in 2 cases vs 13 cases respectively.The findings were length of ventilatory support,off-bed time and duration of antibiotic use differed significantly between the two groups (P < 0.05).Cost-effectiveness ratios based on subjective and objective measures were superior in operative group (1 962.52 and 3 925.03) over those in non-operative group (1 931.48 and 3 718.10),suggesting operative treatment could yield higher economic returns.Conclusion Internal fixation can accelerate bone healing in patients with severer rib fracture and cut down medical expense,which should be promoted in medical treatment.
2.Nitric oxide signal transmission pathway and its regulatory effect on skeletal muscle glucose uptake during exercise
Chinese Journal of Tissue Engineering Research 2007;0(15):-
BACKGROUND: Nitric oxide (NO) can influence glucose transportation. Although its signal transmission pathway is not certain, it has been confirmed that the pathway is different from insulin. OBJECTIVE: To explore NO signal transmission pathway and the regulatory mechanism for the glucose uptake of skeletal muscle during exercise. RETRIEVAL STRATEGY: Using the keywords of "nitric oxide, signal, glucose", we searched the Pubmed database for the relevant articles about the transmission pathway and its regulation of glucose uptake in skeletal muscle published from January 1996 to November 2007. Meanwhile, the related foreign language books were retrieved manually from national library. Articles about the regulation of NO to muscular blood flow, signal transmission and glucose under exercise stress in human and gnawer were selected. Pathologically related basic studies were excluded. LITERATURE EVALUATION: Sixty related literatures (books) were collected, and 30 were accorded with the inclusive criteria, of which 5 were review articles, 23 were basic researches and 2 were related books. Meanwhile, 20 articles were related to the effects of NO on blood flow regulation and vasodilation, 4 articles and 2 books were related to signal transduction and 4 were about its signaling effect during exercise. DATA SYNTHESIS: NO is a signal molecule. It can mediate various biological phenomenon and displays strong vasodilation effect. The production of NO is increased in vivo during exercise, and NO can stimulate glucose uptake in skeletal muscle through its transduction. CONCLUSION: The generation of NO during exercise has positive effect on glucose uptake in skeletal muscle. The contraction and glucose uptake are closely correlated to the generation and transmission of NO, but the mechanism is still unclear.
3.Minimally invasive nercutaneous nephrolithotomy combined with negative pressure system in one-stage treatment of calculus pyonephrosis
Guibin XU ; Xun LI ; Yongzhong HE ; Haibo ZHAO ; Weiqing YANG ; Wei XU ; Gang FENG
Chinese Journal of Urology 2013;(2):93-95
Objective To evaluate the efficacy and safety of minimally invasive percutaneous nephrolithotomy combined with negative pressure system in one-stage treatment of calculus pyonephrosis.Methods Eighty-three cases of calculus pyonephrosis,including 15 upper ureteral calculus cases,9 renal pelvis calculus cases,28 multiple calculus cases and 31 staghorn calculus cases,were retrospectively analysed.The diameter of the stone was from 1.2 to 6.3 cm.All the patients were punctured under X-ray or ultrasound guidance and established an access of 20 F.A 12 F nephroscope,combined with negative pressure system,was inserted to the collecting system to suck off the liquor pus.The stone was fragmented by pneumatic lithotripsy or holmium laser lithotripsy at one-stage.Negative pressure system was used to reduce the intrapelvic pressure during the operation.Results All the patients were treated successfully.The average operative time was 34 ± 19 min.The upper ureteral calculus and renal pelvis calculus cases were all stonefree at one-stage treatment.Of the other 59 cases,33 cases were stone-free and 26 cases need a secondlook.The total stone free rate was 68.7%(57/83)at one-stage and 91.6%(76/83)at second-look.Only 7 patients had fever after operation and no patient had sepsis or shock.Conclusion Combined with negative pressure system,minimally invasive percutaueous nephrolithotomy via a 20 F tract is safe and effective for one-stage treatment of calculus pyonephrosis.
4.Clinical Observation on Endoscopic Treatment of Ureteral Calculi Acute Obstruction with Urinary Extravasation
Guibin MA ; Qiong SUN ; Xingze XU ; Haoyang HE ; Liyu LI ; Zhixing TAO ; Weisheng WANG
Journal of Kunming Medical University 2013;(8):107-109
Objective To investigate the feasibility and safety of endoscopic treatment of ureteral calculi acute obstruction with urinary extravasation. Methods 56 patients with ureteral calculi acute obstruction and urinary extravasation were randomly divided into two groups:the treatment group and the control group,28 cases in each group. Patients in the treatment group were given URSL or percutaneous nephrostomy drainage, and the secondary fistula was given URSL stone clearance treatment. Patients in control group were given traditional ureterolithotomy treatment. The stone clearance rate, the average recovery time after surgery, postoperative wound infection rate and the abnormal rate of postoperative albumin were observed in two groups. Results In the treatment group,28 patients had no residual stones with mean postoperative recovery time of (5.2 1.3) days,postoperative fever was found in 3 cases,obvious abnormal postoperative albumin in 3 cases. In the control group,residual stones were found in 3 cases,the average recovery time after surgery was (7.9 2.6) days,postoperative fever was found in 10 cases, and obvious abnormal postoperative albumin in 11 cases. There were statistically significant differences in stone clearance rate, the average recovery time after surgery, postoperative wound infection rate and the abnormal rate of postoperative albumin between two groups (P<0.05) . Conclusion Endoscopic treatment of ureteral calculi acute obstruction and urinary extravasation has advantages including better efficacy, less trauma, less complications and quicker recovery.
5.Indications and surgical techniques of fixation of rib fractures with memory alloy osteosynthesis plates
Enwu XU ; Guibin QIAO ; Xiufan PENG ; Renchao JIANG ; Zhuohua ZHANG ; Weisheng ZENG
Chinese Journal of Trauma 2012;28(6):533-536
Objective To evaluate the clinical effects of memory alloy embracing fixators in fixation of the rib fractures and investigate the related surgical indications and surgical techniques.Methods Retrospectively review was conducted on the clinical data of 30 patients with rib fractures treated with memory alloy embracing fixators from October 2010 to April 2011 at General Hospital of Guangzhou Military Command.The number of memory alloy embracing fixators used in operation,the number of fixed positions,and operation time were recorded.The pain scores before and after operation were comparatively studied.Operation efficacy and complications were analyzed.Results Of the 30 patients,the total operation time,number of fixators,and number of fixed ribs were (111.9±48.0) minutes,4.3±2.1 and 3.5±1.3,respectively.Meanwhile,the difference between pre-operative and post-operative pain scores was significant (6.93±0.88) points vs (4.04±0.62) points,P<0.05).The ambulation perlod was (4.6±1.9) days and length of hospital stay was (27.2±10.8) days.Incisional and thoracic wall hematoma was detected in three patients and pulmonary infection in six post-operatively but none presented intractable chest pain,foreign body rejection or wound infection.Conclusion Memory alloy embracing fixators for rib fractures is reliable,easy,and effective in alleviating pain,improving lung function,reducing the frequency of ventilator use and preventing complications like lung infection.
6.Application value of enhanced recovery after surgery in minimally invasive radical resection of esophageal cancer
Yong TANG ; Zhu'an OU ; Yan LIU ; Haiping XIAO ; Ming LIAO ; Qihang ZHU ; Zhe HE ; Enwu XU ; Kai SU ; Guibin QIAO
Chinese Journal of Digestive Surgery 2019;18(6):570-574
Objective To investigate the application value of enhanced recovery after surgery with no gastrointestinal decompression tube and with early postoperative oral feeding in minimally invasive radical resectionof esophageal cancer.Methods The retrospective cohort study was conducted.The clinicopathological data of 126 patients who underwent minimally invasive McKeown surgery in the General Hospital of Southern Theatre Command of PLA between March 2016 and October 2017 were collected.There were 80 males and 46 females,aged from 52 to 82 years,with an average age of 64 years.Of 126 patients,82 undergoing "li's anastomosis" with no gastrointestinal decompression tube and receiving early postoperative oral feeding were allocated into non-tube no fasting group,and 44 undergoing end-to-side gastroesophageal anastomosis with tubular stapler,conventionally indwelling gastrointestinal decompression tube,and beginning oral feeding at 1 week after surgery were allocated into traditional treatment group.Observation indicators:(1) surgical and postoperative recovery situations;(2) results of pathological examination;(3) follow-up.Follow-up using outpatient examination and telephone interview was performed to detect the postoperative tumor recurrence and metastasis up to October 2018.Measurement data with normal distribution were represented as Mean ± SD,and comparison between groups was analyzed using independent sample t test.Measurement data with skewed distribution were expressed as M (range),and comparison between groups was analyzed by rank sum test.Count data were described as absolute number or percentage,and comparison between groups was analyzed using chi-square test.Ordinal data were analyzed by rank sum test.Results (1) Surgical and postoperative recovery situations:patients in the two groups underwent minimally invasive McKeown surgery successfully.Operation time,volume of intraoperative blood loss,incidence of anastomotic fistula,incidence of pulmonary complications,and duration of postoperative hospital stay were respectively (326±41) minutes,(225±96) ml,7.3 % (6/82),24.4% (20/82),and 10 days (range,6-90 days) in the non-tube no fasting group and (317± 37) minutes,(214 ± 66) mL,9.1% (4/44),20.5% (9/44),and 14 days (range,10-42 days) in the traditional treatment group;there was a statistically significant difference in duration of postoperative hospital stay between the two groups (Z =-7.129,P < 0.05) and no statistically significant difference in operation time,volume of intraoperative blood loss,incidence of anastomotic fistula,and incidence of pulmonary complications between the two groups (t =1.311,0.703,x2 =0.000,0.077,P>0.05).(2) Results of pathological examination:the number of lymph node dissected,cases in postoperative TNM stage Ⅰ,Ⅱ and Ⅲ were respectively 27±5,12,55,15 in the non-tube no fasting group and 26±5,9,28,7 in the traditional treatment group,with no statistically significant difference between the two groups (t =0.549,Z =-0.747,P>0.05).(3) Follow-up:of 126 patients,116 were followed up for 12-31 months,with a median time of 20 months,including 76 in the non-tube no fasting group and 40 in the traditional treatment group.During the follow-up,no tumor recurrence or metastasis was found in the 116 patients.Conclusion The enhanced recovery after surgery with no gastrointestinal decompression tube and with early postoperative oral feeding is safe and feasible in the McKeown surgery,which can significantly shorten the postoperative hospitalization time compared with the traditional treatment.
7.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
8.Chinese expert consensus on diagnosis, treatment and prevention of venous thrombus embolism associated with chest trauma (2022 version)
Kaibin LIU ; Yi YANG ; Hui LI ; Yonten TSRING ; Zhiming CHEN ; Hao CHEN ; Xinglong FAN ; Congrong GAO ; Chundong GU ; Yutong GU ; Guangwei GUO ; Zhanlin GUO ; Jian HU ; Ping HU ; Hai HUANG ; Lijun HUANG ; Weiwei HE ; Longyu JIN ; Baoli JING ; Zhigang LIANG ; Feng LIN ; Wenpan LIU ; Danqing LI ; Xiaoliang LI ; Zhenyu LI ; Haitao MA ; Guibin QIAO ; Zheng RUAN ; Gang SUI ; Dongbin WANG ; Mingsong WANG ; Lei XUE ; Fei XIA ; Enwu XU ; Quan XU ; Jun YI ; Yunfeng YI ; Jianguo ZHANG ; Dongsheng ZHANG ; Qiang ZHANG ; Zhiming ZHOU ; Zhiqiang ZOU
Chinese Journal of Trauma 2022;38(7):581-591
Chest trauma is one of the most common injuries. Venous thromboembolism (VTE) as a common complication of chest trauma seriously affects the quality of patients′ life and even leads to death. Although there are some consensus and guidelines on the prevention and treatment of VTE at home and abroad, the current literatures lack specificity considering the diagnosis, treatment and prevention of VTE in patients with chest trauma have their own characteristics, especially for those with blunt trauma. Accordingly, China Chest Injury Research Society and editorial board of Chinese Journal of Traumatology organized relevant domestic experts to jointly formulate the Chinese expert consensus on the diagnosis, treatment and prevention of chest trauma venous thromboembolism associated with chest trauma (2022 version). This consensus provides expert recommendations of different levels as academic guidance in terms of the characteristics, clinical manifestations, risk assessment, diagnosis, treatment, and prevention of chest trauma-related VTE, so as to offer a reference for clinical application.
9.Basic principles and quality control of surgical treatment for giant thoracic tumors
Weitao ZHUANG ; Zhen GAO ; Weisheng ZENG ; Enwu XU ; Yong TANG ; Haiping XIAO ; Gang CHEN ; Xiaosong BEN ; Guibin QIAO
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2020;27(09):996-1000
Giant thoracic tumor is currently one of the diagnostic and therapeutic challenges of thoracic surgery, with no established guideline or standard for diagnosis and treatment. The quality control of individualized surgical strategy and perioperative management with multi-disciplinary participation is the key to ensure the safety and improve the prognosis of patients. Based on the clinical experience of our institution and others, we hereby discussed and summarized the basic principles, surgical strategies and perioperative management of giant thoracic tumor, aiming to provide a reference of quality control.
10.Anxiety and depression in the patients with pulmonary nodules and its related influencing factors: A cross-sectional study
Junhan WU ; Weitao ZHUANG ; Haijie XU ; Yong TANG ; Cheng DENG ; Hansheng WU ; Guibin QIAO
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2023;30(03):357-363
Objective To identify the potential factors for psychological burdens and to better understand how the patients’ psychological status affect their treatment preferences. Methods A questionnaire survey was conducted among 996 patients with pulmonary nodules who visited the Thoracic Surgery Clinic of Guangdong Provincial People's Hospital from January to November 2021, including 381 males and 615 females, aged 47.26±11.53 years. A self-administrated questionnaire was used to investigate the sociodemographic and clinical characteristics of the patients, and the Hospital Anxiety and Depression Scale (HADS) was used to evaluate the psychological status of the patients, with a score>7 points of each subscale indicating potential anxiety or depression. Results Among the 996 patients with pulmonary nodules, the incidence of anxiety was 42.4% and the incidence of depression was 26.4%, while the incidence of both anxiety and depression was 24.7%. There was a significant correlation between anxiety and depression (ρ=0.834, P<0.05). Age, purpose of CT examination, number of pulmonary nodules and symptoms were independent factors for anxiety, while symptoms and number of pulmonary nodules were independent factors for depression (P<0.05). For treatment preferences, there was a statistical difference in educational level, symptoms, nodule size and anxiety level (P<0.05). Conclusion Anxiety and depression are common in patients with pulmonary nodules. Symptoms are associated with anxiety and depression, which also make an impact on treatment preferences.