1.Clinical, metabolic, and autoimmune characteristics of newly diagnosed young Filipino adults with diabetes mellitus.
Elizabeth Paz-Pacheco ; Angelique Bea C. Uy ; Angelique Love Tiglao-Gica ; Anna Elvira S. Arcellana ; Aura Bree Dayo-Lacdao ; Cynthia P. Cordero ; Cecilia A. Jimeno ; Ma. Cecille Añ ; onuevo-Cruz ; Noel R. Juban
Acta Medica Philippina 2026;60(2):41-49
OBJECTIVES
In Asia, younger individuals (below age 45) are diagnosed to have type 2 diabetes with increased rates of obesity defined by lower BMI yet with greater visceral adiposity (waist circumference and waisthip ratios). The prevalence data on type 1 diabetes is not well established, considered to be low, but is seen to be increasing as well. This changing phenotype therefore, presents a clinical dilemma in terms of correctly classifying diabetes and deciding on the consequent appropriate treatment. Distinguishing type 1 from type 2 diabetes has become more difficult with type 2 diabetes dramatically increasing in young adults and children. This study aims to define the characteristics of diabetes among young adults in the Philippines to provide a basis for appropriate management amidst changes in diabetes phenotypes seen globally.
METHODSIn this cross-sectional analytic study, we characterized the demographic, metabolic, and autoimmune features of diabetes among young adult Filipinos aged 18 to 45 years old consulting at a tertiary referral center in Manila, Philippines. Baseline serum A1c, FBS, 75-g oral glucose tolerance test, insulin, serum C-peptide, insulin autoantibodies, leptin, adiponectin, lipid profile, and thyroid function tests were obtained from the participants and analyzed. The homeostasis model assessment (HOMA) was used to estimate the insulin sensitivity.
RESULTSA total of 348 patients with diabetes were included, with females comprising two-thirds of the participants. The mean age at diagnosis of diabetes was 35.9±7.22 years. The mean BMI was 28.12 kg/m2, with median waist to hip ratio (WHR) of 0·93. Metabolic syndrome was found in 60% of participants and 67.82% were obese by body mass index. The mean A1c was 9.07±2.52%. Good glucose control (A1c less than 7.0%) was seen in 23% of participants while nearly half (48%) had HbA1c which was >9.0%. The median levels of fasting insulin and C-peptide were 12.62 (range 1.33–90.42) mIU/L and 0.78 ng/mL (range 0–16.2), respectively.
Included participants were diagnosed with diabetes within a year and as such, majority did not have any micro- or macrovascular complications. The most common diabetes complication was sensory neuropathy detected by monofilament testing, which was found in 28% of participants, followed by non-proliferative diabetic retinopathy in 13%. A history of previous diabetic ketoacidosis was found in 10 patients (2.87%). Glutamic acid decarboxylase (GAD) and insulin auto-antibodies were found in 3.2% and 19.3% of participants, respectively. Approximately half (51.73%) of the participants were insulin resistant by HOMA-IR.
CONCLUSIONIn contrast with Caucasians and other Asians, diabetes among young Filipino adults is associated with lower BMI but with a similarly high visceral adiposity as shown by an elevated WHR. Metabolic syndrome with insulin resistance as defined by a variety of indices is predominant. Type 1 diabetes with autoantibodies occur in only a small fraction of this population. Data derived from this work can provide a framework for cluster analysis towards personalized management specific to this population.
Human ; Acids ; Adiponectin ; Adiposity ; Adult ; Aged ; Antibodies ; Asia ; Asian ; Asian Continental Ancestry Group ; Autoantibodies ; Body Mass Index ; C-peptide ; Carboxy-lyases ; Child ; Cluster Analysis ; Demography ; Diabetes Complications ; Diabetes Mellitus ; Diabetes Mellitus, Type 1 ; Diabetes Mellitus, Type 2 ; Diabetic Ketoacidosis ; Diabetic Retinopathy ; Diagnosis ; Fasting ; Female ; Glucose ; Glucose Tolerance Test ; Glutamate Decarboxylase ; Glutamic Acid ; Insulin ; Insulin Resistance ; Ketosis ; Leptin ; Lipids ; Metabolic Syndrome ; Obesity ; Patients ; Peptides ; Phenotype ; Philippines ; Population ; Prevalence ; Serum ; Therapeutics ; Thyroid Gland ; Thyroid Function Tests ; Young Adult
2.One-hour OGTT reveals what conventional screening misses: A hidden prediabetes burden in Malaysia
Gerard Jason Mathews ; Seetha Devi Subramanian ; Nor Shaffinaz Yusoff Azmi Merican ; Shartiyah Ismail ; Joel Mathews ; Leng Ean Charis Kong ; Chong Hui Khaw ; Shubash Shander Ganapathy ; Arvinder-Singh HS
Journal of the ASEAN Federation of Endocrine Societies 2026;41(S1):1-
Introduction:
Prediabetes or intermediate hyperglycemia (IH) represents a critical phase in the trajectory toward type 2 diabetes mellitus
(T2DM). Recent evidence from the International Diabetes Federation (IDF) suggests that 1-hour OGTT (1HOGTT) ≥8.6
mmol/L is a more sensitive biomarker for early beta-cell dysfunction, with enhanced detection of IH and future T2DM
risk. Conventional screening using hemoglobin A1c (HbA1c) or 2-Hour OGTT (2HOGTT) may delay identification
of prediabetes, narrowing the window for early intervention. This study evaluates 1HOGTT as a screening tool for
prediabetes among Malaysians.
Methodology:
This cross-sectional study enrolled adults without prior T2DM or prediabetes. Participants underwent 1HOGTT, 2HOGTT,
and HbA1c, classified as per the Malaysian Clinical Practice Guideline for T2DM (6th Edition) and IDF 2024 criteria.
Agreement between tests was assessed using McNemar’s test and Cohen’s kappa. Diagnostic accuracy was evaluated
via receiver operating characteristic (ROC) curve analysis. Cost-effectiveness was determined using reagent cost only.
Results:
The majority of the 310 participants were female (71.6%), Malay (87.1%), with average age of 40. The 1HOGTT identified
prediabetes in 21.6% (n = 67) compared to 17.1% (n = 53) by HbA1c and 2.6% (n = 8) by 2HOGTT. McNemar’s test confirmed
statistically significant discordance between 1HOGTT and 2HOGTT (chi-square = 53.397, p <0.001): 61 participants were
prediabetic by 1HOGTT but normal by 2HOGTT, versus only 2 in the reverse direction. No significant discordance was
found between 1HOGTT and HbA1c (chi-square = 2.817, p = 0.093). 1HOGTT demonstrated excellent discriminatory
ability against 2HOGTT (AUC = 0.908; 95% CI: 0.837–0.978), significantly outperforming HbA1c (AUC = 0.664; CI: 0.462–
0.867; DeLong p = 0.012). In a population-level cost analysis, 1HOGTT achieved lowest cost per prediabetes case detected
(RM 5.79) – approximately 8.3 times and 8.1 times more cost-effective than 2HOGTT (RM 48.08) and HbA1c (RM 46.78)
respectively.
Conclusion
1HOGTT identifies a significant proportion of individuals with prediabetes missed by 2HOGTT and HbA1c. Incorporating 1HOGTT enhances the detection of prediabetes, is cost-effective, and enables timely preventive measures in our
population with high diabetes burden.
Glucose Tolerance Test
;
Glycated Hemoglobin
;
Prediabetic State
3.Associations of systemic immune-inflammation index and systemic inflammation response index with maternal gestational diabetes mellitus: Evidence from a prospective birth cohort study.
Shuanghua XIE ; Enjie ZHANG ; Shen GAO ; Shaofei SU ; Jianhui LIU ; Yue ZHANG ; Yingyi LUAN ; Kaikun HUANG ; Minhui HU ; Xueran WANG ; Hao XING ; Ruixia LIU ; Wentao YUE ; Chenghong YIN
Chinese Medical Journal 2025;138(6):729-737
BACKGROUND:
The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM.
METHODS:
A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM.
RESULTS:
Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses.
CONCLUSION
The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans
;
Female
;
Pregnancy
;
Diabetes, Gestational/immunology*
;
Prospective Studies
;
Adult
;
Inflammation/immunology*
;
Glucose Tolerance Test
;
Birth Cohort
4.Evaluating serum endosialin (CD248) levels as a diagnostic marker in gestational diabetes.
Tevfik Berk BILDACI ; Can ATA ; Ufuk ATLIHAN ; Huseyin Aytug AVSAR ; Selcuk ERKILINC
Journal of the ASEAN Federation of Endocrine Societies 2025;40(2):65-68
OBJECTIVES
Gestational diabetes mellitus (GDM), a pregnancy-induced hyperglycemia, affects approximately 17% of pregnancies globally. Its pathophysiology remains unclear, with inflammation and vascular remodeling playing key roles. CD248, a glycoprotein linked to inflammation and vascular remodeling, has been implicated in various conditions, but its role in GDM is uncertain.
METHODOLOGYA prospective case-control study was conducted with 169 pregnant women aged 18 to 49 at a tertiary hospital. Serum CD248 levels were assessed at 24 to 28 weeks of gestation prior to the oral glucose tolerance test (OGTT). Statistical analyses evaluated the association between CD248 levels, BMI and GDM status.
RESULTSOf the participants, 32 (18.9%) were diagnosed with GDM. CD248 levels were lower in GDM patients (8.15 ± 10.16 ng/mL) than in controls (11.42 ± 15.44 ng/mL), but the difference was not statistically significant (p = 0.084). Although CD248 levels did not correlate with OGTT values, it was positively associated with BMI (pCONCLUSION
Unlike earlier findings associating elevated CD248 levels with early pregnancy GDM risk, this study found no significant relationship during later gestational stages. These results highlight a potentially complex and context-dependent role for CD248 in GDM pathophysiology.
Human ; Diabetes, Gestational ; Inflammation ; Glucose Tolerance Test
5.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
6.Optimal threshold level of fasting blood sugar and HbA1c to detect pre-diabetes and diabetes based on 75 g OGTT among at-risk Filipino subjects
Charmia Kim G. Balansag ; Ceryl Cindy Tan
Philippine Journal of Internal Medicine 2025;63(4):51-60
BACKGROUND:
The prevalence of pre-diabetes and diabetes mellitus type 2 (DMT2) among Filipinos exceeds 20%. Progressive loss of insulin sensitivity can occur with fasting blood sugar (FBS) ≥90 mg/dL. Studies among Asians with pre- diabetes show a higher prevalence of DMT2 diagnosed by 75 g oral glucose tolerance test (OGTT), the gold standard, which remains underutilized.
OBJECTIVE:
This prospective, observational, single-center study included adult patients admitted between January 2022 to August 2022 who were diagnosed with ARF type 1 and/or 2 and who were hooked to NIV as oxygen supplementation.
METHODOLOGY:
This cross-sectional analysis was conducted in the outpatient departments of two hospitals in Cebu City. Ninety-five adult Filipino patients with FBS < 126 mg/dL but with risk factors for DMT2 had HbA1c and 75 g OGTT taken. Test performance and receiver operating characteristic curves were computed for the optimal FBS and HbA1c threshold.
RESULTS:
Pre-diabetes or DMT2 was prevalent among 66% of participants. Using 75 g OGTT, 23% reached levels indicative of DMT2 but had normal or impaired fasting glucose, while this was found in 20% with pre-diabetic glycated hemoglobin (HbA1c) levels. HbA1c was more accurate than FBS.
CONCLUSION
Performing 75 g OGTT for high-risk Filipinos with FBS ≥94.2 mg/dL or HbA1c ≥5.6% is highly predictive of a change in glucose tolerance status to pre-diabetes, while an FBS ≥106 mg/dL or HbA1c ≥5.8% is predictive of DMT2. Lower cut-off levels promote earlier detection and intervention. Hypertension and age ≥35 years old were significantly associated with such conditions.
Human
;
Diabetes Mellitus
;
Prediabetic State
;
Glycated Hemoglobin
;
Glucose Tolerance Test
7.A systematic review of the accuracy of Insulin and C-peptide secretion ratios during the oral glucose tolerance test to diagnose insulinoma
Fransiskus Mikael Chandra ; Dicky Tahapary
Journal of the ASEAN Federation of Endocrine Societies 2024;39(1):79-83
Background:
Insulinoma is one of the causes of recurrent hypoglycemia, one of the chief complaints for emergency department admission. The gold standard in diagnosing insulinoma is a 72-hour fasting test which is inconvenient and inefficient as it requires hospitalization. Research has found that measurement of insulin and C-peptide during OGTT may help diagnose insulinoma. We aimed to assess the diagnostic value of OGTT in diagnosing insulinoma.
Methodology:
The literature search was conducted on 19 August 2022 using several databases (MEDLINE, Scopus, Embase, and ScienceDirect). All studies that measured OGTT as diagnostic tools in diagnosing insulinoma and 72-hour fasting test as reference standard were included. The quality assessment of the selected studies was based on the Centre of Evidence-Based Medicine University of Oxford and the Quality Assessment of Diagnostic Accuracy-2 tool (QUADAS-2). Analysis of the included studies was performed qualitatively. This study was registered on PROSPERO (CRD42022360205).
Results:
A total of two case-control studies (106 patients) were included, which were at risk of bias and low concern of applicability. Both studies demonstrated that the combination of insulin and C-peptide levels measured during OGTT had high specificity, sensitivity, positive predictive value, and negative predictive value in diagnosing insulinoma compared to the reference standard. A logistic regression model of 8.305 – (0.441 × insulin 2-h/0-h) – (1.679 × C-peptide 1-h/0-h) > 0.351 has the highest diagnostic value in one study (AUC 0.97, Sensitivity 86.5%, Specificity 95.2%, PPV 94.1, NPV 88.9).
Conclusion
The measurement of 0-h and 2-h insulin and C-peptide levels during 2-h OGTT was found in two small case-control studies with a total of 106 patients to have good sensitivity and specificity. However, due to these limitations, future research is still needed to validate the potential use of OGTT for the diagnosis of insulinoma.
Insulinoma
;
Glucose Tolerance Test
8.Associations between plasma n-3 polyunsaturated fatty acids and gestational diabetes mellitus in the second trimester.
Yan LIU ; Yi Xiang YE ; Yi WANG ; Fan WANG ; Yi Chao HUANG ; Da CHEN ; Xiong Fei PAN ; An PAN
Chinese Journal of Preventive Medicine 2022;56(3):312-321
Objective: To examine the associations between plasma n-3 polyunsaturated fatty acids (PUFAs) in the second trimester and gestational diabetes mellitus (GDM) among Chinese pregnant women. Methods: Based on data from the Tongji-Shuangliu Birth Cohort enrolled from 2017 to 2019 in the Shuangliu Maternal and Child Health Hospital, it conducted a case-control study among 269 GDM cases who were diagnosed by 75 g oral glucose tolerance test, and 538 non-GDM controls matched at a 1∶2 ratio on maternal age and gestational weeks. The age range of the 807 women was 18-40 years. Fasting plasma n-3 PUFAs were determined by gas chromatography-mass spectrometry in the second trimester (24-28 weeks). Participants were categorized into quartiles (Q1-Q4) of plasma n-3 PUFAs based on distributions in the control group. Conditional logistic regression models were applied to estimate the associations between plasma n-3 PUFAs and GDM. Results: The median (interquartile) relative concentrations of plasma n-3 PUFA C22∶5n-3 was significantly lower in women with GDM 0.87 (0.72, 1.07) compared with women without GDM 0.94 (0.75, 1.19)(P=0.001). Plasma n-3 PUFA C22∶5n-3 was inversely associated with GDM, with an OR (95%CI) of 0.75 (0.62-0.90) for each SD increase of relative concentration. Compared with the Q1 group, the OR values and 95%CIs of Q2, Q3, and Q4 groups were 0.97 (0.62-1.51), 0.72 (0.45-1.15), and 0.54 (0.32-0.90), respectively (Ptrend<0.05). However, there were no significant associations of C18∶3n-3, C20∶5n-3, C22∶6n-3, and total n-3 PUFAs with GDM. Conclusion: Plasma n-3 PUFA C22∶5n-3 was inversely associated with GDM during the second trimester.
Case-Control Studies
;
Child
;
Diabetes, Gestational
;
Fatty Acids, Unsaturated
;
Female
;
Glucose Tolerance Test
;
Humans
;
Pregnancy
;
Pregnancy Trimester, Second
9.Skin diseases in the Da Qing Diabetes Study: a cross-sectional study.
Chang-Bing SHEN ; Xin QIAN ; Rui-Xing YU ; Xue-Lei JI ; Yin-Juan SHI ; Jing GAO ; Cheng-Xu LI ; Ke-Ke LI ; Wen-Min FEI ; Xue SHEN ; Zi-Yi WANG ; Yang HAN ; Xiao-Li NING ; Randy KO ; Yi-Hsiang HSU ; Xian-Yong YIN ; Guang-Wei LI ; Yong CUI
Chinese Medical Journal 2021;134(10):1191-1198
BACKGROUND:
The prevalence of skin diseases and diabetes mellitus (DM) are prominent around the world. The current scope of knowledge regarding the prevalence of skin diseases and comorbidities with type 2 DM (T2DM) is limited, leading to limited recognition of the correlations between skin diseases and T2DM.
METHODS:
We collected 383 subjects from the Da Qing Diabetes Study during the period from July 9th to September 1st, 2016. The subjects were categorized into three groups: Normal glucose tolerance (NGT), impaired glucose tolerance (IGT), and T2DM. The prevalence and clinical characteristics of skin diseases were recorded and investigated.
RESULTS:
In this cross-sectional study, 383 individuals with ages ranging from 53 to 89-year-old were recruited. The overall prevalence of skin diseases was 93.5%, and 75.7% of individuals had two or more kinds of skin diseases. Additionally, there were 47 kinds of comorbid skin diseases in patients with T2DM, of which eight kinds of skin diseases had a prevalence >10%. The prevalence of skin diseases in NGT, IGT, and T2DM groups were 93.3%, 91.5%, and 96.6%, respectively; stratified analysis by categories showed a statistically significant difference in "disturbances of pigmentation" and "neurological and psychogenic dermatoses". The duration of T2DM also significantly associated with the prevalence of "disturbances of pigmentation" and "neurological and psychogenic dermatoses". Subsequently, the prevalence of "disturbances of pigmentation" was higher in males than females in NGT (P < 0.01) and T2DM (P < 0.01) groups. In addition, the difference in the prevalence of "disturbances of pigmentation" was also significant in NGT and T2DM groups (P < 0.01).
CONCLUSIONS
There was a high prevalence of skin diseases in the Da Qing Diabetes Study. To address the skin diseases in the Da Qing Diabetes Study, increased awareness and intervention measures should be implemented.
Aged
;
Aged, 80 and over
;
Blood Glucose
;
Cross-Sectional Studies
;
Diabetes Mellitus, Type 2/epidemiology*
;
Female
;
Glucose Intolerance/epidemiology*
;
Glucose Tolerance Test
;
Humans
;
Male
;
Middle Aged
;
Skin Diseases/epidemiology*
10.Inverted U-Shaped Associations between Glycemic Indices and Serum Uric Acid Levels in the General Chinese Population: Findings from the China Cardiometabolic Disease and Cancer Cohort (4C) Study.
Yuan Yue ZHU ; Rui Zhi ZHENG ; Gui Xia WANG ; Li CHEN ; Li Xin SHI ; Qing SU ; Min XU ; Yu XU ; Yu Hong CHEN ; Xue Feng YU ; Li YAN ; Tian Ge WANG ; Zhi Yun ZHAO ; Gui Jun QIN ; Qin WAN ; Gang CHEN ; Zheng Nan GAO ; Fei Xia SHEN ; Zuo Jie LUO ; Ying Fen QIN ; Ya Nan HUO ; Qiang LI ; Zhen YE ; Yin Fei ZHANG ; Chao LIU ; You Min WANG ; Sheng Li WU ; Tao YANG ; Hua Cong DENG ; Jia Jun ZHAO ; Lu Lu CHEN ; Yi Ming MU ; Xu Lei TANG ; Ru Ying HU ; Wei Qing WANG ; Guang NING ; Mian LI ; Jie Li LU ; Yu Fang BI
Biomedical and Environmental Sciences 2021;34(1):9-18
Objective:
The relationship between serum uric acid (SUA) levels and glycemic indices, including plasma glucose (FPG), 2-hour postload glucose (2h-PG), and glycated hemoglobin (HbA1c), remains inconclusive. We aimed to explore the associations between glycemic indices and SUA levels in the general Chinese population.
Methods:
The current study was a cross-sectional analysis using the first follow-up survey data from The China Cardiometabolic Disease and Cancer Cohort Study. A total of 105,922 community-dwelling adults aged ≥ 40 years underwent the oral glucose tolerance test and uric acid assessment. The nonlinear relationships between glycemic indices and SUA levels were explored using generalized additive models.
Results:
A total of 30,941 men and 62,361 women were eligible for the current analysis. Generalized additive models verified the inverted U-shaped association between glycemic indices and SUA levels, but with different inflection points in men and women. The thresholds for FPG, 2h-PG, and HbA1c for men and women were 6.5/8.0 mmol/L, 11.0/14.0 mmol/L, and 6.1/6.5, respectively (SUA levels increased with increasing glycemic indices before the inflection points and then eventually decreased with further increases in the glycemic indices).
Conclusion
An inverted U-shaped association was observed between major glycemic indices and uric acid levels in both sexes, while the inflection points were reached earlier in men than in women.
Aged
;
Asian Continental Ancestry Group
;
Blood Glucose/analysis*
;
China/epidemiology*
;
Cohort Studies
;
Diabetes Mellitus/blood*
;
Female
;
Glucose Tolerance Test
;
Glycated Hemoglobin A/analysis*
;
Glycemic Index
;
Humans
;
Male
;
Middle Aged
;
Uric Acid/blood*


Result Analysis
Print
Save
E-mail