Objective To investigate anti-inflammatory effect of recombinant human erythropoietin(rhEPO) on bronchopulmonary dysplasia in newborn rats exposed to hyperoxia.Methods Ninety-six Wistar newborn rats were randomly divided into 4 groups after birth:room air-exposed control group,room air-exposed rhEPO treated group,hyperoxia-exposed group,and the hyperoxia-exposed rhEPO treated group.The last two groups were exposed to oxygen,FiO2 =850 mL/L,room air-exposed rhEPO treated and hyperoxia-exposed rhEPO treated group received rhEPO 2 400 IU/kg subcutaneously at birth,30 minutes' before oxygen exposure and 2 d after birth.The isodose of 9 g/L saline was given in the same way in room air-exposed controls and hyperoxia-exposed pups.Rats from each group were sacrificed on day 3,7 and 10.Lung histology was observed under microscope,and mRNA expression of monocyte chemoattractant protein-1 (MCP-1) and cytokine-induced neutrophil hemoattractant-1 (CINC-1) were determined with reverse transcriotion-polymerase chain reaction(RT-PCR).Results Under microscope,in the hyperoxia-exposed group,inflammatory cell influx was detected in the lungs on the 3rd day and there was marked neutrophlic infiltrate on the 7th day.Alveolar enlargement and fibrosis were evident on the 10th day.At the same time,the histopathological changes were improved greatly in the lungs of hyperoxia-exposed rhEPO treated pups compared with the hyperoxia-exposed pups.MCP-1 and CINC-1 mRNA expression increased in hyperoxia-exposed pups,compared with room air-exposed controls especially on the 7th day [(0.94 ± 0.45) vs (0.21 ± 0.03),P ＜ 0.001 ; (1.26 ± 0.29) vs (0.26 ± 0.06),P ＜ 0.001].MCP-1 and CINC-1 mRNA expression were greatly depressed in the hyperoxia-exposed rhEPO treated pups compared with the hyperoxia-exposed pups especially on the 7th day.[(0.65 ± 0.07) vs (0.94 ± 0.45),P＜0.05;(0.83±0.07) vs (1.26±0.29),P＜0.05].Conclusions The therapy of rhEPO (2 400 IU/kg) therapy can reduce lung inflammatory cell infiltration and alveolar fibrin deposition in newborn rats with hyperoxic lung injury,and it can restrain MCP-1 and CINC-1 mRNA expression.The anti-inflammatory mechanism of rhEPO is related to inhibition of MCP-l and CINC-1 mRNA expression.

Objective:to construct and test the structural equation model of influencing factors of clinical nursing teaching quality, and analyze the influencing factors and strength of clinical nursing teaching quality.Methods:Based on the literature, 20 indexes influencing the quality of clinical nursing teaching were selected. In July 2019, clinical nursing teachers of a third class a medical institution were selected for convenient sampling survey. Through factor analysis, 20 indexes were classified into 6 dimensions, namely, teaching environment, teaching attitude, teacher quality, teacher behavior, teaching management and teaching quality.Results:The structural equation model of influencing factors of clinical nursing teaching quality was constructed. The fitting index of the model reached the standard value, and the model had a good fit.Conclusion:With the help of this model, the nursing administrators can find out the factors and intensity that affect the quality of clinical nursing teaching, which is helpful to put forward the improvement strategies of improving the quality of clinical nursing teaching, to improve the effect of clinical nursing teaching, to improve the quality of clinical nursing teaching, and to provide reference for the research of similar clinical nursing teaching quality.

OBJECTIVE:To optimize the extraction technology of Duoxuekang. METHODS:Using comprehensive score of salidroside,gallic acid content and extraction yield as indexes,U6(63)uniform design was designed to optimize the liquid-solid ra-tio,ethanol volume fraction and extraction time of Duoxuekang,then optimize extraction times,and verification test was conduct-ed. RESULTS:The optimal extraction technology was as follows as 50% ethanol,liquid-solid ratio of 1:14,soaking time of 1.5 h,reflux extraction for 1 h and repeated twice;the average extraction yield in 3 tests was 50.18%,contents of salidroside and gal-lic acid were 1.82 mg/g,16.54 mg/g (RSD≤0.84%,n=3). CONCLUSIONS:The optimized extraction technology for Duox-uekang is reasonable,simple and feasible.

Objective To investigate MRI appearances of aquaporin(AQP) and its effect in different brain regions of patients with Parkinson's disease(PD).Methods A prospective study was carried out in 33 PD patients(PD group) and 23 gender-and age-matched healthy controls (control group).Clinical data of PD patients were collected.The aquaporin imaging of diffusion-weighted magnetic resonance imaging (MRDWI) with multiple b-values in different brain regions were performed to detect the apparent diffusion coefficient(AQP-ADC) values of aquaporin.The PD patients were assessed and graded by modified Hoehn-Yahr grading,then the AQP-ADC values of control group,mild PD group,moderate and severe PD group were analyzed using one-way analysis of variance.The correlation analysis was carried out to detect the relationship between AQP-ADC values in different brain regions and Hoehn-Yahr grading of PD patients.Results Compared with control group,mild PD group had significantly higher AQP-ADC values in red nucleus(RN) and globus pallidus(GP) ((0.24±0.04) vs (0.21±0.04),(0.21±0.04) vs (0.16±0.04);both P＜0.05);while the AQP-ADC values in RN and GP of moderate and severe PD group were significantly lower than that of mild PD group((0.21±0.02) vs (0.24±0.04),(0.18±0.03) vs (0.21±0.04);both P＜0.05);but there was no significant difference between moderate and severe PD group and control group(P＞0.05);and there was also no significant difference in substantianigra (SN),putamen (Pu) and thalamus (THA) among control group,mild PD group and moderate and severe PD group(P＞0.05).The correlation analysis showed that there were negative correlations between the AQP-ADC values in RN and GP and Hoehn-Yahr grading(r=-0.479 and-0.395,P＜ 0.05),while there was no correlation in SN,Pu and THA (P＞ 0.05).Conclusion The AQPADC values are increased in RN and GP of mild PD patients,and decreased in moderate and severe PD patients,while there is no significant change in SN,Pu and THA of the two groups,suggesting that the expression of AQP in different brain regions may be related to the severity and pathological stage of PD.

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

Objective:To explore the application effect of medical science competition in nursing interns whocontribute to "healthy China" , and to improve their health education awareness, ability, method and self-confidence.Methods:A total of 205 nursing interns who worked in Union Hospital of Tongji Medical College of Huazhong University of Science and Technology from 2019 to 2020 were selected as the research objects. They were divided into the control group (105 cases) and the experimental group (100 cases) according to whether they participated in the medical science competition. The control group learned the form and method of health education in clinical rotation according to the traditional practice teaching plan. The experimental group volunteered to participate in the medical science competition, which required the dissemination of health knowledge through various forms. Before and after the competition, the health education ability assessment scale was used for comparison.Results:Before the medical science competition, there was no significant difference in the total score of assessment, planning, implementation, evaluation and health education between the control group and the experimental group ( t values were 0.765 - 1.749, all P>0.05). After the medical science competition, the total scores of assessment, planning, implementation, evaluation and health education ability of nursing interns in the experimental group were (24.38 ± 4.72), (17.98 ± 3.98), (25.16 ± 5.36), (12.57 ± 2.96) and (80.09 ± 15.65) respectively, while those in the control group were (22.45 ± 6.29), (16.61 ± 4.77), (23.04 ± 6.55), (11.31 ± 3.46) and (73.41 ± 19.69).The differences between the two groups were statistically significant ( t values were 2.226 - 2.795, all P<0.05). Conclusions:The medical science competition can improve the health education ability of assessment, planning, implementation, evaluation of nursing interns and contribute to "healthy China" .

Objective:To evaluate the feasibility of making individualized scanning and contrast injection protocol based on body mass index (BMI) and body weight during dynamic myocardial computed perfusion (CTP) imaging in order to get high-quality images while drastically reducing radiation dose.Methods:A total of 128 patients with coronary heart disease diagnosed by coronary CTA (CCTA) performed CTP from June, 2019 to March, 2020 were prospectively enrolled. Patients were divided into six groups: group 1, BMI<24 kg/m 2, ≤60 kg, 70 kV; group 2,BMI<24 kg/m 2, 61≤kg≤70, 70 kV; group 3, BMI 24-28 kg/m 2, 61≤kg≤70, 80 kV; group 4, BMI 24-28 kg/m 2, 71≤kg≤80, 80 kV; group 5, BMI 24-28 kg/m 2,>80 kg, 80 kV;group 6, BMI>28 kg/m 2,>80 kg, 100 kV. 200 mA was fixed for all patients. Contrast agent with iodine containing 370 mg/ml was used in all patients. The iodine delivery rates (IDR) for each group was 0.8, 1.0, 1.2, 1.4, 1.6, 2.0 g/s, respectively. The attenuation and noise of left ventricle (LV) and septal myocardial were measured to calculate signal to noise ratio (SNR) and contrast to noise ratio (CNR) of the images in each group. The Shapiro-Wilk test was conducted to assess the normality of quantitative data. Quantitative variables were compared using one-way ANOVA if normally distributed. Results:The LV attenuation of the six groups were (506±85), (513±77), (510±81), (456±74), (477±111), (462±43) HU, respectively. There was no significant difference among them ( F=2.249, P=0.054). SNR values of LV were 23±8, 20±5, 21±5, 19±4, 19±7, 19±4, and CNR values were 19±7, 17±4, 17±4, 16±4, 15±6, 15±4, respectively. There were no significant differences among them ( F=1.674, 1.736, all P>0.05). Under a single CTP scan, the radiation dose of 70, 80 and 100 kV groups were 1.6, 2.3 and 4.3 mSv, respectively. The does of the 70 kV group and 80 kV group were significantly lower than that of the 100 kV group, and the dose of the 70 kV group was also significantly lower than that of the 80 kV group (all P<0.001). Conclusions:The application of individualized scanning and contrast agent injection protocol based on IDR is feasible in myocardial CTP with successful image quality, and the radiation dose decreases significantly.

Objective To investigate the diagnosis,surgical therapy of congenital pyloric atresia in neonates.Method Six congenital pyloric atresia neonates in Children's Hospital of Nanjing Medical University were admitted,including 4 cases of complete atresia with pyloric diaphragm,1 case of incomplete atrsia with a foraminula in the pyloric diaphragm and 1 case of pyloric atresia with solid segment.Three cases were associated with epidermolysis bullosa,multiple intestinal atresia and annular pancreas respectively.Results The main presenting symptoms were nonbilious vomiting,and 5 cases of abdominal X-ray plain film showed a large single gastric air-bubble and no gas distally.Ultrasonography and upper gastrointestinal radiography showed complete gastric outlet obstruction,and in 1 case postbulbar obstruction.Neonates with pyloric diaphragm underwent diaphragm excision and pyloroplasty,and that with solid segment did an extended pyloroplasty.The one complicating intestinal atresia was abandened surgery.Five cases were followed up,and doing well with complete recovery.Conclusion Abdominal X-ray plain film,Doppler ultrasonography and upper gastrointestinal radiography help establish the diagnosis of neonatal congenital pyloric atresia.Surgery is the therapy of choice and the prognosis is very good.

Objective:To investigate the clinical efficacy and side effects of programmed death receptor 1 (PD-1) inhibitor in the treatment of relapsed/refractory non-Hodgkin's lymphoma (NHL).Methods:The clinical data of 31 patients with relapsed/refractory NHL treated with PD-1 inhibitor alone in Linyi Cancer Hospital from July 2018 to December 2021 were retrospectively analyzed. The clinical efficacy and adverse reactions were also analyzed.Results:After 3-4 cycles of PD-1 inhibitor treatment alone, 13 cases achieved partial remission, 3 cases achieved stable disease and 15 cases had the progression of disease. The objective remission rate was 41.9% (13/31), and the disease control rate was 51.6% (16/31). The objective remission rate of patients with peripheral T-cell lymphoma was 42.9% (9/21), and the disease control rate was 57.1% (12/21). By the end of follow-up in July 30, 2022, the median progression-free survival time was 8 months (95% CI 1.6-14.4 months) and the median overall survival time was 15 months (95% CI 5.7-24.3 months). The incidence of adverse reactions in the whole group was 67.7% (21/31), of which grade 1-2 occurred in 20 cases, and grade 3-4 occurred in 1 case. Conclusions:PD-1 inhibitor has a certain effect in the treatment of relapsed/refractory NHL; the overall incidence of adverse drug reactions is high, but they are all controllable.

Objective:To investigate the diagnostic value of cerebrospinal fluid interleukin-6 (IL-6), neuron-specific enolase (NSE) and S100B protein in patients with central nervous system infection.Methods:The clinical data of 78 patients with central nervous system infection (infected group) from October 2015 to February 2019 in the Department of Neurology, Affiliated Hospital of Xuzhou Medical University were retrospectively analyzed. Among the patients, viral meningitis was in 41 cases, tuberculous meningitis was in 23 cases, and purulent meningitis was in 14 cases. Another 100 patients who were admitted to the hospital during the same period for cerebrospinal fluid and other related examinations and excluded central nervous system infection (control group) were selected. Enzyme-linked immunosorbent assay was used to detect the levels of IL-6, NSE and S100B protein.Results:The cerebrospinal fluid levels of IL-6, NSE and S100B protein in infected group were significantly higher than those in control group: 16.70 (8.54, 228.18) ng/L vs. 6.64 (4.96, 8.21) ng/L, 13.62 (11.50, 19.01) μg/L vs. 9.95 (7.54, 12.39) μg/L and 3.07 (0.24, 11.57) μg/L vs. 0.16 (0.12, 0.21) μg/L, and there were statistical differences ( P<0.05). The cerebrospinal fluid levels of IL-6, NSE and S100B protein in patients with tuberculous meningitis were significantly higher than those in patients with viral meningitis and patients with purulent meningitis: 173.30 (13.74, 503.80) ng/L vs. 9.37 (4.80, 113.55) and 89.96 (14.02, 239.60) ng/L, (30.82 ± 14.09) μg/L vs. (12.00 ± 2.33) and (17.62 ± 5.63) μg/L, (18.29 ± 16.05) μg/L vs. (2.12 ± 1.24) and (5.79 ± 4.82) μg/L; the indexes in patients with purulent meningitis were significantly higher than those in patients with viral meningitis, and there were statistical differences ( P<0.05). Conclusions:Cerebrospinal fluid IL-6, NSE and S100B proteins have different expressions in patients with different types of central nervous system infection, and have certain clinical application value for the diagnosis of central nervous system infection.