1.Recombinant human erythropoietin attenuates pulmonary inflammatory in newborn rats with chronical hyperoxia-induced bronchopulmonary dysplasia
Linlin GENG ; Wei LYU ; Jingrong SONG
Chinese Journal of Applied Clinical Pediatrics 2015;30(2):134-136
Objective To investigate anti-inflammatory effect of recombinant human erythropoietin(rhEPO) on bronchopulmonary dysplasia in newborn rats exposed to hyperoxia.Methods Ninety-six Wistar newborn rats were randomly divided into 4 groups after birth:room air-exposed control group,room air-exposed rhEPO treated group,hyperoxia-exposed group,and the hyperoxia-exposed rhEPO treated group.The last two groups were exposed to oxygen,FiO2 =850 mL/L,room air-exposed rhEPO treated and hyperoxia-exposed rhEPO treated group received rhEPO 2 400 IU/kg subcutaneously at birth,30 minutes' before oxygen exposure and 2 d after birth.The isodose of 9 g/L saline was given in the same way in room air-exposed controls and hyperoxia-exposed pups.Rats from each group were sacrificed on day 3,7 and 10.Lung histology was observed under microscope,and mRNA expression of monocyte chemoattractant protein-1 (MCP-1) and cytokine-induced neutrophil hemoattractant-1 (CINC-1) were determined with reverse transcriotion-polymerase chain reaction(RT-PCR).Results Under microscope,in the hyperoxia-exposed group,inflammatory cell influx was detected in the lungs on the 3rd day and there was marked neutrophlic infiltrate on the 7th day.Alveolar enlargement and fibrosis were evident on the 10th day.At the same time,the histopathological changes were improved greatly in the lungs of hyperoxia-exposed rhEPO treated pups compared with the hyperoxia-exposed pups.MCP-1 and CINC-1 mRNA expression increased in hyperoxia-exposed pups,compared with room air-exposed controls especially on the 7th day [(0.94 ± 0.45) vs (0.21 ± 0.03),P < 0.001 ; (1.26 ± 0.29) vs (0.26 ± 0.06),P < 0.001].MCP-1 and CINC-1 mRNA expression were greatly depressed in the hyperoxia-exposed rhEPO treated pups compared with the hyperoxia-exposed pups especially on the 7th day.[(0.65 ± 0.07) vs (0.94 ± 0.45),P<0.05;(0.83±0.07) vs (1.26±0.29),P<0.05].Conclusions The therapy of rhEPO (2 400 IU/kg) therapy can reduce lung inflammatory cell infiltration and alveolar fibrin deposition in newborn rats with hyperoxic lung injury,and it can restrain MCP-1 and CINC-1 mRNA expression.The anti-inflammatory mechanism of rhEPO is related to inhibition of MCP-l and CINC-1 mRNA expression.
2.Applying structural equation model to construct the index of influencing factors of clinical nursing teaching quality
Li ZENG ; Li GENG ; Zhuoya ZHANG ; Yongli LYU
Chinese Journal of Practical Nursing 2021;37(5):390-396
Objective:to construct and test the structural equation model of influencing factors of clinical nursing teaching quality, and analyze the influencing factors and strength of clinical nursing teaching quality.Methods:Based on the literature, 20 indexes influencing the quality of clinical nursing teaching were selected. In July 2019, clinical nursing teachers of a third class a medical institution were selected for convenient sampling survey. Through factor analysis, 20 indexes were classified into 6 dimensions, namely, teaching environment, teaching attitude, teacher quality, teacher behavior, teaching management and teaching quality.Results:The structural equation model of influencing factors of clinical nursing teaching quality was constructed. The fitting index of the model reached the standard value, and the model had a good fit.Conclusion:With the help of this model, the nursing administrators can find out the factors and intensity that affect the quality of clinical nursing teaching, which is helpful to put forward the improvement strategies of improving the quality of clinical nursing teaching, to improve the effect of clinical nursing teaching, to improve the quality of clinical nursing teaching, and to provide reference for the research of similar clinical nursing teaching quality.
3.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
4.MRI appearances of aquaporin and its effect in different brain regions of patients with Parkinson's disease
Shuiqing LYU ; Yonghai LIU ; Jiali WANG ; Kai XU ; Deqin GENG ; Weiwei XU ; Dunjing WANG
Chinese Journal of Behavioral Medicine and Brain Science 2016;25(5):427-431
Objective To investigate MRI appearances of aquaporin(AQP) and its effect in different brain regions of patients with Parkinson's disease(PD).Methods A prospective study was carried out in 33 PD patients(PD group) and 23 gender-and age-matched healthy controls (control group).Clinical data of PD patients were collected.The aquaporin imaging of diffusion-weighted magnetic resonance imaging (MRDWI) with multiple b-values in different brain regions were performed to detect the apparent diffusion coefficient(AQP-ADC) values of aquaporin.The PD patients were assessed and graded by modified Hoehn-Yahr grading,then the AQP-ADC values of control group,mild PD group,moderate and severe PD group were analyzed using one-way analysis of variance.The correlation analysis was carried out to detect the relationship between AQP-ADC values in different brain regions and Hoehn-Yahr grading of PD patients.Results Compared with control group,mild PD group had significantly higher AQP-ADC values in red nucleus(RN) and globus pallidus(GP) ((0.24±0.04) vs (0.21±0.04),(0.21±0.04) vs (0.16±0.04);both P<0.05);while the AQP-ADC values in RN and GP of moderate and severe PD group were significantly lower than that of mild PD group((0.21±0.02) vs (0.24±0.04),(0.18±0.03) vs (0.21±0.04);both P<0.05);but there was no significant difference between moderate and severe PD group and control group(P>0.05);and there was also no significant difference in substantianigra (SN),putamen (Pu) and thalamus (THA) among control group,mild PD group and moderate and severe PD group(P>0.05).The correlation analysis showed that there were negative correlations between the AQP-ADC values in RN and GP and Hoehn-Yahr grading(r=-0.479 and-0.395,P< 0.05),while there was no correlation in SN,Pu and THA (P> 0.05).Conclusion The AQPADC values are increased in RN and GP of mild PD patients,and decreased in moderate and severe PD patients,while there is no significant change in SN,Pu and THA of the two groups,suggesting that the expression of AQP in different brain regions may be related to the severity and pathological stage of PD.
5.Application of medical science popularization competition in nursing interns from the perspective of healthy China
Zhuoya ZHANG ; Li GENG ; Li ZENG ; Yongli LYU ; Jiao YANG ; Ying HU
Chinese Journal of Practical Nursing 2021;37(13):1027-1031
Objective:To explore the application effect of medical science competition in nursing interns whocontribute to "healthy China" , and to improve their health education awareness, ability, method and self-confidence.Methods:A total of 205 nursing interns who worked in Union Hospital of Tongji Medical College of Huazhong University of Science and Technology from 2019 to 2020 were selected as the research objects. They were divided into the control group (105 cases) and the experimental group (100 cases) according to whether they participated in the medical science competition. The control group learned the form and method of health education in clinical rotation according to the traditional practice teaching plan. The experimental group volunteered to participate in the medical science competition, which required the dissemination of health knowledge through various forms. Before and after the competition, the health education ability assessment scale was used for comparison.Results:Before the medical science competition, there was no significant difference in the total score of assessment, planning, implementation, evaluation and health education between the control group and the experimental group ( t values were 0.765 - 1.749, all P>0.05). After the medical science competition, the total scores of assessment, planning, implementation, evaluation and health education ability of nursing interns in the experimental group were (24.38 ± 4.72), (17.98 ± 3.98), (25.16 ± 5.36), (12.57 ± 2.96) and (80.09 ± 15.65) respectively, while those in the control group were (22.45 ± 6.29), (16.61 ± 4.77), (23.04 ± 6.55), (11.31 ± 3.46) and (73.41 ± 19.69).The differences between the two groups were statistically significant ( t values were 2.226 - 2.795, all P<0.05). Conclusions:The medical science competition can improve the health education ability of assessment, planning, implementation, evaluation of nursing interns and contribute to "healthy China" .
6.Feasibility of individualized scanning and contrast agent injection protocol to reduce the radiation dose of dynamic myocardial perfusion imaging
Wei MA ; Na ZHAO ; Yang GAO ; Wenlei GENG ; Xingping BAN ; Bin LYU
Chinese Journal of Radiology 2021;55(4):409-414
Objective:To evaluate the feasibility of making individualized scanning and contrast injection protocol based on body mass index (BMI) and body weight during dynamic myocardial computed perfusion (CTP) imaging in order to get high-quality images while drastically reducing radiation dose.Methods:A total of 128 patients with coronary heart disease diagnosed by coronary CTA (CCTA) performed CTP from June, 2019 to March, 2020 were prospectively enrolled. Patients were divided into six groups: group 1, BMI<24 kg/m 2, ≤60 kg, 70 kV; group 2,BMI<24 kg/m 2, 61≤kg≤70, 70 kV; group 3, BMI 24-28 kg/m 2, 61≤kg≤70, 80 kV; group 4, BMI 24-28 kg/m 2, 71≤kg≤80, 80 kV; group 5, BMI 24-28 kg/m 2,>80 kg, 80 kV;group 6, BMI>28 kg/m 2,>80 kg, 100 kV. 200 mA was fixed for all patients. Contrast agent with iodine containing 370 mg/ml was used in all patients. The iodine delivery rates (IDR) for each group was 0.8, 1.0, 1.2, 1.4, 1.6, 2.0 g/s, respectively. The attenuation and noise of left ventricle (LV) and septal myocardial were measured to calculate signal to noise ratio (SNR) and contrast to noise ratio (CNR) of the images in each group. The Shapiro-Wilk test was conducted to assess the normality of quantitative data. Quantitative variables were compared using one-way ANOVA if normally distributed. Results:The LV attenuation of the six groups were (506±85), (513±77), (510±81), (456±74), (477±111), (462±43) HU, respectively. There was no significant difference among them ( F=2.249, P=0.054). SNR values of LV were 23±8, 20±5, 21±5, 19±4, 19±7, 19±4, and CNR values were 19±7, 17±4, 17±4, 16±4, 15±6, 15±4, respectively. There were no significant differences among them ( F=1.674, 1.736, all P>0.05). Under a single CTP scan, the radiation dose of 70, 80 and 100 kV groups were 1.6, 2.3 and 4.3 mSv, respectively. The does of the 70 kV group and 80 kV group were significantly lower than that of the 100 kV group, and the dose of the 70 kV group was also significantly lower than that of the 80 kV group (all P<0.001). Conclusions:The application of individualized scanning and contrast agent injection protocol based on IDR is feasible in myocardial CTP with successful image quality, and the radiation dose decreases significantly.
7.Optimization of Extraction Technology for Tibetan Medicine Duoxuekang by Uniform Design
Xiumei LYU ; Jing WANG ; Kehui ZHAO ; Jing ZHANG ; Xianrong LAI ; Gang FAN ; Yi ZHANG ; Zangjia GENG
China Pharmacy 2017;28(10):1361-1364
OBJECTIVE:To optimize the extraction technology of Duoxuekang. METHODS:Using comprehensive score of salidroside,gallic acid content and extraction yield as indexes,U6(63)uniform design was designed to optimize the liquid-solid ra-tio,ethanol volume fraction and extraction time of Duoxuekang,then optimize extraction times,and verification test was conduct-ed. RESULTS:The optimal extraction technology was as follows as 50% ethanol,liquid-solid ratio of 1:14,soaking time of 1.5 h,reflux extraction for 1 h and repeated twice;the average extraction yield in 3 tests was 50.18%,contents of salidroside and gal-lic acid were 1.82 mg/g,16.54 mg/g (RSD≤0.84%,n=3). CONCLUSIONS:The optimized extraction technology for Duox-uekang is reasonable,simple and feasible.
8.Congenital pyloric atresia in neonates
Qiming GENG ; Weibing TANG ; Jie ZHANG ; Huan CHEN ; Changgui LU ; Xiaofeng LYU ; Weiwei JIANG ; Wei LI ; Xiaoqun XU
Chinese Journal of General Surgery 2017;32(4):348-350
Objective To investigate the diagnosis,surgical therapy of congenital pyloric atresia in neonates.Method Six congenital pyloric atresia neonates in Children's Hospital of Nanjing Medical University were admitted,including 4 cases of complete atresia with pyloric diaphragm,1 case of incomplete atrsia with a foraminula in the pyloric diaphragm and 1 case of pyloric atresia with solid segment.Three cases were associated with epidermolysis bullosa,multiple intestinal atresia and annular pancreas respectively.Results The main presenting symptoms were nonbilious vomiting,and 5 cases of abdominal X-ray plain film showed a large single gastric air-bubble and no gas distally.Ultrasonography and upper gastrointestinal radiography showed complete gastric outlet obstruction,and in 1 case postbulbar obstruction.Neonates with pyloric diaphragm underwent diaphragm excision and pyloroplasty,and that with solid segment did an extended pyloroplasty.The one complicating intestinal atresia was abandened surgery.Five cases were followed up,and doing well with complete recovery.Conclusion Abdominal X-ray plain film,Doppler ultrasonography and upper gastrointestinal radiography help establish the diagnosis of neonatal congenital pyloric atresia.Surgery is the therapy of choice and the prognosis is very good.
9.Clinical observation of programmed death receptor 1 inhibitor alone in treatment of relapsed/refractory non-Hodgkin lymphoma
Jian LYU ; Qin GENG ; Zhen WANG
Journal of Leukemia & Lymphoma 2023;32(9):524-527
Objective:To investigate the clinical efficacy and side effects of programmed death receptor 1 (PD-1) inhibitor in the treatment of relapsed/refractory non-Hodgkin's lymphoma (NHL).Methods:The clinical data of 31 patients with relapsed/refractory NHL treated with PD-1 inhibitor alone in Linyi Cancer Hospital from July 2018 to December 2021 were retrospectively analyzed. The clinical efficacy and adverse reactions were also analyzed.Results:After 3-4 cycles of PD-1 inhibitor treatment alone, 13 cases achieved partial remission, 3 cases achieved stable disease and 15 cases had the progression of disease. The objective remission rate was 41.9% (13/31), and the disease control rate was 51.6% (16/31). The objective remission rate of patients with peripheral T-cell lymphoma was 42.9% (9/21), and the disease control rate was 57.1% (12/21). By the end of follow-up in July 30, 2022, the median progression-free survival time was 8 months (95% CI 1.6-14.4 months) and the median overall survival time was 15 months (95% CI 5.7-24.3 months). The incidence of adverse reactions in the whole group was 67.7% (21/31), of which grade 1-2 occurred in 20 cases, and grade 3-4 occurred in 1 case. Conclusions:PD-1 inhibitor has a certain effect in the treatment of relapsed/refractory NHL; the overall incidence of adverse drug reactions is high, but they are all controllable.
10.Perioperative pain nursing from 2012 to 2017 in China: a bibliometric analysis
Nan LYU ; Hui ZHU ; Ke GENG ; Xiaomin CHEN
Chinese Journal of Modern Nursing 2019;25(8):929-933
Objective? To systematically analyze the research status and development trend of perioperative pain nursing in China, so as to provide an evidence-based basis and research direction for perioperative pain nursing. Methods? We built the literature review data base and analyzed the perioperative pain nursing related literatures included by China National Knowledge Infrastructure (CNKI), WanFang data and VIP database from 2012 to 2017 with the method of bibliometrics. Results? A total of 1 467 literatures were retrieved. The number of literatures was increasing year by year and then declined slightly. The literature sources were main in journal articles published in 269 kinds of journals. The types of literatures focused on clinical trials followed by reviews and case analysis. There were 191 (13.08%) literatures cited more than 5 times and the highest times cited were 165 times. There were 85 literatures supported by research fund accounted for 5.79%. Conclusions? In recent years, perioperative pain nursing has attracted much attention by researchers in China. However, the group of core authors has not be built. Besides,study types were unbalanced and the overall quality of literatures was low. Researchers should increase the breadth and depth of perioperative pain nursing and explore more perioperative pain nursing plans, which are applicable to our country.