OBJECTIVE: To explore the molecular basis for a rare case with Para-Bombay AB blood type. METHODS: Serological method was used to determine the blood type of the proband. Exons 6 and 7 of the ABO gene and the coding regions of FUT1 and FUT2 genes were analyzed by direct sequencing. RESULTS: Serological results showed that the proband was a Para-Bombay AB subtype. His genotype was determined as ABO*A1.02/B.01. The proband was also found to harbor c.551-552delAG and c.881-882delTT of the FUT1 gene. For his four children, there were three type B and one type A, though the expression of the H type was normal. CONCLUSION The double deletions in the coding region of the FUT1 gene probably underlay the Para-Bombay blood type in the proband. Carrier of single-strand deletions may have a normal ABO phenotype.
ABO Blood-Group System/genetics* ; Alleles ; Fucosyltransferases/genetics* ; Genotype ; Humans ; Male ; Phenotype ; Sequence Analysis

To elucidate the clinical significance of phenotypic alterations of Lewis antigen in gastric cancer patients, we investigated Lewis antigens by analyzing the genotypes of the Le and Se genes and by comparing the results obtained with the phenotypic expression of Lewis antigen in gastric cancer tissue and blood cells. One hundred and twenty gastric cancer patients were examined and compared with respect to Lewis blood phenotype and genotype. The expression of Lea, Leb, sialylated Lea, and sialylated Lex antigens was immunohistochemically examined in uninvolved gastric mucosa, intestinal metaplasia, and cancerous tissue. We also analyzed the significance of Lewis antigen expression by analyzing patient survival. The frequencies of the Lewis phenotypes of RBCs corresponding to Le(a+b-), Le(a-b+), and Le(a-b-) were 16%, 58%, and 26%, respectively. The Le and le allele gene frequencies calculated from genotyping in gastric cancer patients were 0.623 and 0.377, respectively. The frequency for Le(a-b-) of the RBC phenotype had a tendency to be higher in cancer patients than in normal healthy Koreans. However, no difference in the Lewis gene frequency was found between these gastric cancer patients and healthy persons. The phenotype of Le(a-b+) was most prevalent in uninvolved gastric mucosal tissue, whereas the most prevalent form in tumor tissue was Le(a-b-). Sialyl-Lea and sialyl-Lex antigens were hardly detectable in uninvolved gastric mucosa, whereas the two antigens were expressed highly in intestinal metaplastic mucosa and tumor cells. In conclusion, the loss of Lewis antigen expression in tissue and on RBCs in gastric cancer patients is not a result of genetic influences, but rather a result of sialylation in tissue. We also confirm that poor prognosis is associated with dimeric sialyl-Lex and vascular spread.
Adult ; Aged ; Alleles ; Erythrocytes/*chemistry ; Female ; Fucosyltransferases/*analysis/genetics ; Gangliosides/analysis ; Genotype ; Human ; Immunohistochemistry ; Male ; Metaplasia ; Middle Age ; Oligosaccharides/analysis ; Phenotype ; Stomach Neoplasms/*blood/genetics/mortality

OBJECTIVETo investigate the molecular genetic basis of para-Bombay phenotype in a Chinese family.

METHODSABO and H phenotypes of the proband and his pedigree were characterized by serological techniques. The exons 6 and 7 of the ABO gene and full coding region of alpha-1,2-fucosyltransferase (FUT1) gene of the pedigree were analyzed by polymerase chain reaction and direct sequencing of the amplified fragments. The haplotypes of compound heterozygote of the FUT1 gene were also analyzed by cloning sequencing.

RESULTSThree para-Bombay phenotypes were identified in nine family members by serological technology. Three heterozygous variants (35C/T, 235G/C and 682A/G) were found in FUT1 gene of the proband, and the hapotype of FUT1 gene was h(235C)/h(35T+628G)according to the cloning sequencing. The alleles h(235C)and h(35T+628G) caused G79R, A12V and M228V amino acid substitutions in alpha-1,2-fucosyltransferase, respectively.

CONCLUSIONA novel 235G>C mutation of FUT1 gene which was associated with para-Bombay phenotype was found in the Chinese pedigree.

ABO Blood-Group System ; genetics ; Alleles ; Female ; Fucosyltransferases ; genetics ; Gene Frequency ; genetics ; Haplotypes ; genetics ; Humans ; Male ; Mutation ; Pedigree ; Sequence Analysis, DNA

OBJECTIVETo study two cases of rare para-Bombay blood types Bmh and Amh in order to determine clinical strategies of blood transfusion.

METHODSABO blood type was determined with serological assays. The samples were also genotyped with polymerase chain reaction-sequence specific primer (PCR-SSP) for potential mutations in α-1,2-fucosyltransferase gene (FUT1). The results were verified with direct sequencing.

RESULTSTwo rare para-Bombay blood types, namely Bmh and Amh, were identified by serological method, with one being BO1 which contained a FUT1 allele 547-548delAG deletion (h1h1), and another being A205O2 which contained FUT1 allele a 547-548delAG deletion and a FUT1 allele 658C/T missense mutation (h1h3).

CONCLUSIONFUT1 allele 547-548delAG deletion and 658C>T missense mutation in part form the molecular basis of para-Bombay blood types. As Bmh and Amh contain anti-HI in sera, great attention should be paid to avoid adverse reaction of blood transfusion in clinics.

ABO Blood-Group System ; genetics ; Base Sequence ; Blood Grouping and Crossmatching ; DNA Mutational Analysis ; Exons ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Mutation ; Sequence Analysis, DNA

OBJECTIVEThis is a study on the allele composing of ABO, FUT1 and FUT2 gene loci of 10 para-Bombay individuals in China.

METHODSTen samples coming from different districts of China were suspected of para-Bombay phenotype by primary serology tests. Routine and absorb-elution tests were conducted to identify their ABO type, and duplex polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was applied to getting their ABO genotype. Most of them were submitted to a test of their Lewis type as well. Then through direct DNA sequencing with PCR products of FUT1 and FUT2 genes, the genotypes of their H and SE gene loci were analyzed.

RESULTSIt can be confirmed that the 10 samples are para-Bombay. All of their ABO genotypes are consistent with the serological absorb-elution results and the substances detected results in saliva. Seven out of 10 have recessive homozygous gene at their H locus. Each phenotype of h1h1 (nt547-552Deltaag), h2h2 (nt880-882Deltatt) and h4h4 (nt35 t-->c) are ascertained in 2 individuals; moreover, h3h3 (nt 658 c-->t) is identified in one individual. The rest are hh heterozygous individuals: one is h3/h(new-1); the other is h2/h(new-2); the last one is h1/h2. The h(new-1) (nt586 c-->t) allele has a point mutation at nt 586 C to T, which leads a nonsense mutation Gln(CAG) to stop (TAG).The second h (new-2) (nt328 g-->a) has an nt328 G to A missense mutation,which leads Ala (GCC),was replaced by Thr (ACC) at 110 amino acid position. All the 10 samples have Se (nt357 c-->t) synonymous mutation. One Bm(h) (B/O) individual with h4h4 phenotype has a Se(w)(nt357 c-->t; nt385 a-->t) allele, whose Lewis type is Le(a+b+). Moreover, the authors detected a (nt716 g-->a) mutation in two samples' Se gene.

CONCLUSIONFour kinds of known h alleles (h1-h4), 2 kinds of novel non-functional FUT1 alleles, a Se(w) allele, and a novel SeG716A polymorphism in Chinese para-Bombay individuals were detected. At the same time, the authors noticed that all the 10 samples have the nt357 c-->t mutation in their FUT2 gene.

ABO Blood-Group System ; genetics ; Alleles ; China ; DNA Mutational Analysis ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Isoenzymes ; genetics ; Mutation, Missense ; Polymerase Chain Reaction ; Polymorphism, Restriction Fragment Length

This study was aimed to explore the molecular mechanisms for para-Bombay phenotype formation. The H antigen of these individuals were identified by serological techniques. The full coding region of alpha (1, 2) fucosyltransferase (FUT1) gene of these individuals was amplified by high-fidelity polymerase chain reaction (PCR). PCR product was identified by TOPO cloning sequencing. Analysis and comparison were used to explore the mechanisms of para-bombay phenotype formation in individuals. The results indicated that the full coding region of FUT1 DNA was successfully amplified by PCR and gel electrophoresis. DNA sequencing and analysis found that h1 (547-552delAG) existed in one chromosome and h4 (35C > T) existed in the other chromosome of NO.1 individual. Meantime, h1 (547-552delAG) was found in two chromosomes of NO.2 and NO.3 individual. It also means that FUT1 gene of NO.1 individual was h1h4 heterozygote, FUT1 gene of NO.2 and NO.3 individuals were h1h1 homozygote. It is concluded that homozygous and heterozygous mutation of FUT1 gene can lead to the formation of para-Bombay phenotype.
ABO Blood-Group System ; genetics ; Adolescent ; Adult ; Aged ; Alleles ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; DNA Mutational Analysis ; Female ; Fucosyltransferases ; genetics ; Genotype ; Heterozygote ; Homozygote ; Humans ; Male ; Phenotype

This study was aimed to investigate the molecular mechanisms for para-Bombay blood type individual in Fujian Province of China. The para-Bombay blood type of this individual was identified by routine serological techniques. The full coding region of alpha (1,2) fucosyltransferase (FUT1) gene of this individual was amplified by polymerase chain reaction (PCR), then the PCR product was cloned into T vector. The mutation in coding region of fut1 gene was identified by TA cloning, so as to explore the molecular mechanisms for para-Bombay blood type individual. The results indicated that the full coding region of fut1 gene was successfully amplified by PCR. AG deletion at position 547-552 on 2 homologous chromosomes was detected by TA cloning method, leading to a reading frame shift and a premature stop codon. It is concluded that genetic mutation of fut1 gene in this para-bombay blood type individual was h1h1 homozygotic type.
ABO Blood-Group System ; genetics ; Aged ; Asian Continental Ancestry Group ; genetics ; China ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Male ; Mutation ; Sequence Analysis, DNA

OBJECTIVEMolecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.

METHODSSeven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.

RESULTSThe FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.

CONCLUSIONA novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.

Alleles ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; Ethnic Groups ; genetics ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Pedigree ; Phenotype ; Polymerase Chain Reaction ; Sequence Analysis, DNA ; Serologic Tests

To investigate the molecular genetics basis for one para-Bombay phenotype, the red blood cell phenotype of the proband was characterized by standard serological techniques. Exon 6 and 7 of ABO gene, the entire coding region of FUT1 gene and FUT2 gene were amplified by polymerase chain reaction from genomic DNA of the proband respectively. The PCR products were purified by agarose gels and directly sequenced. The PCR-SSP and genescan were performed to confirm the mutations detected by sequencing. The results showed that the proband ABO genotype was A(102)A(102). Two heterozygous mutations of FUT1 gene, an A to G transition at position 682 and AG deletion at position 547-552 were detected in the proband. A682G could cause transition of Met-->Val at amino acid position 228, AG deletion at position 547-552 caused a reading frame shift and a premature stop codon. The FUT2 genotype was heterozygous for a functional allele Se(357) and a weakly functional allele Se(357), 385 (T/T homozygous at position 357 and A/T heterozygous at 385 position). It is concluded that the compound heterozygous mutation--a novel A682G missense mutation and a 547-552 del AG is the molecular mechanism of this para-Bombay phenotype.
ABO Blood-Group System ; genetics ; China ; DNA Mutational Analysis ; Female ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Male ; Mutation ; Mutation, Missense ; Pedigree ; Phenotype ; Sequence Deletion

OBJECTIVETo explore the molecular mechanism for a case with para-Bombay phenotype caused by α-1,2-fucosyltransferase (FUT1) gene mutations.

METHODSBlood phenotype of the propositus was determined by standard serological testing. Polymerase chain reaction-sequence specific primer (PCR-SSP) and direct sequencing of PCR product were used to analyze its ABO genotype. The PCR product of FUT1 gene was sequenced and analyzed.

RESULTSThe phenotype of the propositus was initially detected as para-Bombay A type. Direct sequencing of ABO gene showed that the genotype of the proband was A101/O01 (261G/del), which was consistent with the result of PCR-SSP. Two homo-mutations, 35C>T and 658C>T, were detected in the FUT1 gene by sequencing, and the genotype was determined as h(35T+658T)/h(35T+658T).

CONCLUSIONh(35T+658T)/h(35T+658T) is responsible for the para-Bombay phenotype of the propositus. The genotype is rare even in para-Bombay populations.

ABO Blood-Group System ; genetics ; Base Sequence ; DNA Mutational Analysis ; methods ; DNA Primers ; Fucosyltransferases ; genetics ; Genotype ; Homozygote ; Humans ; Male ; Phenotype ; Point Mutation ; Polymerase Chain Reaction