Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

The antidepressant activity and molecular mechanisms of Yueju Wan volatile oil were investigated. The Yueju Wan volatile oil was extracted by using supercritical CO_2. Gas chromatography-mass spectrometry(GC-MS) combined with network pharmacology identified 28 chemical constituents in Yueju Wan volatile oil, primarily terpenes and lactones. A total of 123 overlapping targets were associated with depression, including core targets of interleukin-1β(IL-1β), signal transducer and activator of transcription 3(STAT3), and caspase-3(CASP3). These targets were mainly involved in the prolactin, advanced glycation end products/receptor(AGE/RAGE), and phosphoinositide 3-kinase/protein kinase B(PI3K/Akt) signaling pathways. A reserpine-induced depression mouse model was established to evaluate the therapeutic effects and mechanisms of Yueju Wan volatile oil. The effects of Yueju Wan volatile oil on depression-like behavior in mice were evaluated by analyzing body mass, body temperature index, tail suspension immobility time, forced swimming immobility time, and sucrose preference. Hematoxylin-eosin(HE) staining revealed neuronal protection of Yueju Wan volatile oil in the brain of mice. Enzyme-linked immunosorbent assay(ELISA) and Western blot were employed to detect the protein expression of AGEs, IL-1β, phosphorylated PI3K(p-PI3K), Akt, phosphorylated Akt(p-Akt), nuclear factor κB(NF-κB), and brain-derived neurotrophic factor(BDNF). Behavioral evaluation showed that Yueju Wan volatile oil could effectively control the decline of body mass and body temperature of depressed mice, reduce tail suspension and swimming immobility time, and enhance their preference for sucrose. Histopathological examination showed that Yueju Wan volatile oil could alleviate the neuronal damage in CA1 and dentate gyrus(DG) of the hippocampus of mice. ELISA and Western blot results showed that Yueju Wan volatile oil could significantly increase the protein expression levels of PI3K, Akt, and BDNF and significantly decrease the protein expression levels of AGEs, IL-1β, p-PI3K, p-Akt, and NF-κB in the hippocampus of mice. Furthermore, the p-PI3K/PI3K and p-Akt/Akt ratios were significantly decreased at medium and high doses. These findings suggest that the aromatherapy of Yueju Wan volatile oil can significantly improve reserpine-induced depression-like behavior in mice, which may be related to reducing the expression of neuronal membrane protein AGEs, reducing the phosphorylation levels of PI3K and Akt, inhibiting NF-κB entry into the nucleus, and alleviating the release of pro-inflammatory factors and nerve injury.
Animals ; Antidepressive Agents/chemistry* ; Mice ; Proto-Oncogene Proteins c-akt/immunology* ; Phosphatidylinositol 3-Kinases/immunology* ; Oils, Volatile/chemistry* ; Male ; Drugs, Chinese Herbal/chemistry* ; Signal Transduction/drug effects* ; Depression/metabolism* ; Glycation End Products, Advanced/immunology* ; Humans

Geniposidic acid(GA), a natural iridoid, exists in the roots, stems, leaves, flowers, bark, fruits, and seeds of medicinal plants of Rubiaceae, Eucommiaceae, and Plantaginaceae. Modern pharmacological studies have revealed that GA has multiple pharmacological activities, including organ-protective, anti-inflammatory, antioxidative, anti-osteoporosis, anti-neurodegenerative, and anti-cardiovascular effects. GA can enhance cell/organism defenses by upregulating key anti-inflammatory and antioxidant cytokines, while downregulating key node proteins in pro-inflammatory signaling pathways such as AhR and TLR4/MyD88, thereby exerting pharmacological effects such as organ protection. Pharmacokinetic investigations have suggested that after oral administration, GA can be distributed in multiple organs(kidney, liver, heart, spleen, lung, etc.). In addition, the pharmacokinetic behavior of GA could be significantly altered under disease conditions, as demonstrated by a marked increase in systematic exposure. This article comprehensively summarizes the reported pharmacological activities and mechanisms and systematically analyzes the pharmacokinetic characteristics and key parameters of GA, with the aim of providing a theoretical basis and scientific reference for the precise clinical application of GA-related Chinese patent medicines, as well as for the investigation and development of innovative drugs based on GA.
Humans ; Drugs, Chinese Herbal/chemistry* ; Animals ; Iridoid Glucosides/chemistry* ; Plants, Medicinal/chemistry* ; Anti-Inflammatory Agents/pharmacology*

OBJECTIVE: To explore the co-morbid influencing factors of postmenopausal osteoporosis(PMOP) and dyslipidemia, and to provide evidence-based basis for clinical co-morbidity management. METHODS: Based on the 2017 to 2018 Beijing community cross-sectional survey data, PMOP patients were included and divided into the dyslipidemia group and the uncomplicated dyslipidemia group according to whether they were comorbid with dyslipidemia. Demographic characteristics, living habits and disease history were collected through questionnaires, and bone mineral density and bone metabolism biomarkers (osteocalcin, blood calcium, serum typeⅠprocollagen N-terminal prepeptide, etc.) were detected on site. Co-morbidity risk factors were analyzed using binary logistic regression. RESULTS: Three hundred and twenty patients with PMOP were included, including the comorbid group (75 patients) and the uncomplicated group (245 patients). The results showed that history of cardiovascular disease [OR=1.801, 95%CI(1.003, 3.236), P=0.049], history of cerebrovascular disease [OR=2.923, 95%CI(1.460, 5.854), P=0.002], frying and cooking methods[OR=5.388, 95%CI(1.632, 17.793), P=0.006], OST results[OR=0.910, 95%CI(0.843, 0.983), P=0.016], and blood Ca results [OR=60.249, 95%CI(1.862, 1 949.926), P=0.021] were the influencing factors of PMOP complicated with dyslipidemia. CONCLUSION Focus should be placed on the influencing factors of PMOP and dyslipidemia co-morbidities, with emphasis on multidimensional assessment, combining lifestyle interventions with bone metabolism marker monitoring to optimize co-morbidity management.
Humans ; Dyslipidemias/epidemiology* ; Female ; Middle Aged ; Osteoporosis, Postmenopausal/metabolism* ; Aged ; Cross-Sectional Studies ; Risk Factors ; Bone Density

Male factors contribute to 50% of infertility cases, with 20%-30% of cases being solely attributed to male infertility. Helicase for meiosis 1 ( HFM1 ) plays a crucial role in ensuring proper crossover formation and synapsis of homologous chromosomes during meiosis, an essential process in gametogenesis. HFM1 gene mutations are associated with male infertility, particularly in cases of non-obstructive azoospermia and severe oligozoospermia. However, the effects of intracytoplasmic sperm injection (ICSI) in HFM1 -related infertility cases remain inadequately explored. This study identified novel biallelic HFM1 variants through whole-exome sequencing (WES) in a Chinese patient with severe oligozoospermia, which was confirmed by Sanger sequencing. The pathogenicity of these variants was assessed using real-time quantitative polymerase chain reaction (RT-qPCR) and immunoblotting, which revealed a significant reduction in HFM1 mRNA and protein levels in spermatozoa compared to those in a healthy control. Transmission electron microscopy revealed morphological abnormalities in sperm cells, including defects in the head and flagellum. Despite these abnormalities, ICSI treatment resulted in a favorable fertility outcome for the patient, indicating that assisted reproductive techniques (ART) can be effective in managing HFM1 -related male infertility. These findings offer valuable insights into the management of such cases.
Humans ; Male ; Sperm Injections, Intracytoplasmic ; Oligospermia/therapy* ; Adult ; Spermatozoa/ultrastructure* ; Exome Sequencing ; Mutation

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To study the epidemiological characteristics of respiratory syncytial virus (RSV) infection in hospitalized children with community-acquired pneumonia (CAP) in Hebei Province. METHODS: Hospitalized children with CAP who tested positive for RSV and were admitted to Hebei Children's Hospital from various cities and counties across Hebei Province between January 2019 and December 2023 were included in the study. Clinical data were collected and analyzed to assess epidemiological characteristics. RESULTS: The clinical data of 43 978 children with CAP were collected, with an overall RSV detection rate of 25.98%. The detection rate was higher during the implementation of non-pharmaceutical interventions (NPIs) (30.60%) than in the non-NPIs period. Winter and spring were the primary epidemic seasons for RSV each year except in 2022. The detection rate in males (26.62%) was higher than in females (25.06%) (P<0.001). The highest detection rate (59.18%) was found in infants aged 29 days to <1 year. Single RSV infection was more common, with rhinovirus being the most frequent co-infection. CONCLUSIONS The overall RSV detection rate in Hebei Province is influenced by NPIs, being higher during their implementation. RSV predominantly circulates in winter and spring. The detection rate of RSV is higher in males and infants. RSV infection is primarily single, most often co-occurring with rhinovirus.
Humans ; Respiratory Syncytial Virus Infections/epidemiology* ; Female ; Male ; Infant ; Child, Preschool ; Seasons ; China/epidemiology* ; Infant, Newborn ; Community-Acquired Infections/epidemiology* ; Child

OBJECTIVE: To explore the construction method of a resistant multiple myeloma (MM) patient-derived xenotransplantation (PDX) model. METHODS: 1.0×10⁷ MM patient-derived mononuclear cells (MNCs), 2.0×10⁶ MM.1S cells and 2.0×10⁶ NCI-H929 cells were respectively subcutaneously inoculated into NOD.CB17-Prkdc^scid Il2rg^tm1/Bcgen (B-NDG) mice with a volume of 100 μl per mouse to establish mouse model. The morphologic, phenotypic, proliferative and genetic characteristics of PDX tumor were studied by hematoxylin-eosin staining, immunohistochemical staining (IHC), cell cycle analysis, flow cytometry and fluorescence in situ hybridization (FISH). The sensitivity of PDX tumor to bortezomib and anlotinib monotherapy or in combination was investigated through cell proliferation, apoptosis and in vitro and in vivo experiments. The effects of anlotinib therapy on tumor blood vessel and cell apoptosis were analyzed by IHC, TUNEL staining and confocal fluorescence microscope. RESULTS: MM PDX model was successfully established by subcutaneously inoculating primary MNCs. The morphologic features of tumor cells from MM PDX model were similar to those of mature plasma cells. MM PDX tumor cells positively expressed CD138 and CD38, which presented 1q21 amplification, deletion of Rb1 and IgH rearrangement, and had a lower proliferative activity than MM cell lines. in vitro, PDX, MM.1S and NCI-H929 cells were treated by bortezomib and anlotinib for 24 hours, respectively. Cell viability assay showed that the IC₅₀ value of bortezomib were 5 716.486, 1.025 and 2.775 nmol/L, and IC₅₀ value of anlotinib were 5 5107.337, 0.706 and 5.13 μmol/L, respectively. Anlotinib treatment increased the apoptosis of MM.1S cells (P < 0.01), but did not affect PDX tumor cells (P >0.05). in vivo, there was no significant difference in PDX tumor growth between bortezomib monotherapy group and control group (P >0.05), while both anlotinib monotherapy and anlotinib combined with bortezomib effectively inhibited PDX tumor growth (both P < 0.05). The vascular perfusion and vascular density of PDX tumor were decreased in anlotinib treatment group (both P < 0.01). The apoptotic cells in anlotinib treatment group were increased compared with those in control group (P < 0.05). CONCLUSION Bortezomib-resistant MM PDX model can be successfully established by subcutaneous inoculation of MNCs from MM patients in B-NDG mice. This PDX model, which retains the basic biological characteristics of MM cells, can be used to study the novel therapies.
Animals ; Bortezomib ; Humans ; Multiple Myeloma/pathology* ; Mice ; Apoptosis ; Drug Resistance, Neoplasm ; Cell Line, Tumor ; Xenograft Model Antitumor Assays ; Mice, Inbred NOD ; Disease Models, Animal ; Cell Proliferation ; Transplantation, Heterologous