It is believed that the basic mechanism of cough associated with interstitial lung disease is collaterals deficiency with latent wind： the deficiency of the lung organs and lung collaterals is the basis of its pathogenesis， and latent wind in lung collaterals is the key mechanism of the cough which is difficult to cure. Treatment is based on the principle of supplementing deficiency and treating wind， dispelling the pathogens and unblocking the collaterals. Supplementing deficiency should supplement lungs， boost kidneys， and strengthen spleens to consolidate the root and banking up the origin， and regulate and tonify the lung collaterals； dispelling the pathogens should treat the internal and external winds at the same time， and taking into account the combined pathogens of phlegm， stasis and dampness to clear the stagnation of the lung collaterals.

ObjectiveTo investigate the analgesic effect of Tuina at the "Weizhong （BL 40）" on neuropathic pain in a rat model of chronic constriction injury （CCI） of the sciatic nerve and its potential central spinal mechanisms. MethodsThirty-two Sprague-Dawley rats were randomly divided into four groups （8 rats in each group）， sham-operated group， model group， Tuina group， and blockade group. The CCI model was established in the model group， Tuina group， and the blockade group by ligating the sciatic nerve with catgut， while the sham-operated group underwent only sciatic nerve exposure without ligation. From postoperative day 4 to day 14， rats in the Tuina group and the blockade group received Tuina manipulation at the "Weizhong （BL 40）" using a dynamic pressure distribution measurement system （5 N pressure， 2 Hz frequency， 10 min per session， once daily）. The blockade group also received intraperitoneal injections of the microglial inhibitor minocycline （10 mg/kg） once daily. The sham-operated and the model group underwent the same handling and fixation as the Tuina group without actual Tuina. Mechanical withdrawal threshold （MWT） and paw withdrawal latency （PWL） were measured before surgery and on day 3， 7， 10， and 14 post-surgery. Transmission electron microscopy was used to evaluate sciatic nerve injury and repair， measuring axon diameter and total myelinated fiber diameter to calculate the g-ratio. Western Blotting was performed to detect the protein levels of ionized calcium-binding adapter molecule 1 （Iba-1）， CD206， CD68， interleukin-10 （IL-10）， and β-endorphin （β-EP） precursor pro-opiomelanocortin （POMC） in the ipsilateral spinal dorsal horn. ResultsCompared with the sham-operated group， the model group showed significantly reduced MWT and PWL on day 3， 7， 10， and 14 （P＜0.01）. Compared with the model group， the Tuina group and the blockade group showed increased MWT and PWL on day 10 and 14 （P＜0.05）. Compared with the Tuina group， the blockade group exhibited higher MWT on day 7， 10， and 14， and higher PWL on day 10 （P＜0.05）. Sciatic nerve pathological morphology revealed intact and well-structured myelin in the sham-operated group， while the model group exhibited myelin collapse， distortion， and myelin ovoid formation. The Tuina group displayed partially irregular myelin with occasional myelin collapse， whereas the blockade group exhibited partial myelin irregularities and phospholipid shedding. Compared with the sham-operated group， the model group showed a decreased g-ratio and increased levels of Iba-1 and CD68 in the spinal dorsal horn （P＜0.05 or P＜0.01）. Compared with the model group， the Tuina group and the blockade group exhibited an increased g-ratio and reduced Iba-1 and CD68 levels. Additionally， the Tuina group showed elevated levels of CD206， IL-10， and POMC， whereas the blockade group had decreased CD206 levels （P＜0.05）. ConclusionTuina at "Weizhong （BL 40）" alleviates neuropathic pain in CCI rats， potentially by regulating microglial activation in the spinal cord， inhibiting M1 polarization while promoting M2 polarization， and activating the IL-10/β-EP pathway to exert analgesic effects.

ObjectiveTo investigate the effects of Xijiao Dihuangtang （XJDHT） on mice with sepsis and cellular models of sepsis and explore its molecular mechanism in alleviating sepsis-induced inflammatory responses via regulating pyruvate kinase M2 （PKM2）-mediated one-carbon metabolism pathway. MethodsForty C57BL/6N mice were randomly divided into four groups： normal group， model group， low-dose XJDHT group （7.7 g·kg^-1）， and high-dose XJDHT group （15.4 g·kg^-1）. After one week of continuous gavage， sepsis was induced using cecal ligation and puncture （CLP） in groups except the normal group. 24 h after the surgery， mortality rates in all groups were recorded， and serum cytokines were measured by enzyme linked immunosorbent assay （ELISA）. Lung histopathology was examined by hematoxylin-eosin （HE） staining. During the in vitro experiment， the human monocytic leukemia cell line （THP-1） was exposed to various concentrations of XJDHT and treated with lipopolysaccharide （LPS） at a final concentration of 2 mg·L^-1 for 24 h. Cell apoptosis was detected using terminal deoxynucleotidyl transferase dUTP nick end labeling （TUNEL） assay. Protein levels of tumor necrosis factor-α （TNF-α）， interleukin-1β （IL-1β）， B-cell lymphoma 2 （Bcl-2）， and Bcl-2-associated X protein （Bax） were measured by Western blot. Transcriptome sequencing was performed to analyze differentially expressed genes in all groups and conduct gene ontology （GO） enrichment. Key genes in the one-carbon metabolism pathway， including pyruvate kinase M2 （PKM2）， 5-methyltetrahydrofolate-homocysteine methyltransferase （MTR）， and phosphoglycerate dehydrogenase （PHGDH）， were verified by Western blot. A PKM2 inhibition model was established using shikonin for further protein expression analysis. ResultsAnimal experiments showed that compared with the normal group， the model group exhibited significantly elevated body temperature and lung pathology （P<0.01） and increased serum TNF-α and IL-1β levels （P<0.01）. High-dose XJDHT reduced body temperature and lung tissue damage （P<0.01） and significantly decreased serum TNF-α and IL-1β levels （P<0.01）. Low-dose XJDHT treatment showed no significant temperature change （P<0.01） but reduced serum TNF-α and IL-1β levels （P<0.01）. Transcriptome sequencing and Western blot revealed significant differences in the expression of TNF-α， IL-1β， and one-carbon metabolism genes （PKM2， MTR， and PHGDH） （P<0.01）. Cell experiments demonstrated that compared to the normal group， the model group showed elevated protein expressions of TNF-α and IL-1β in THP-1 cells （P<0.01）， decreased Bcl-2/Bax ratio， and increased apoptosis （P<0.01）. Transcriptome sequencing and Western blot revealed significant differences in the expression of TNF-α， IL-1β， and one-carbon metabolism genes （PKM2， MTR， and PHGDH） （P<0.01）. Compared to the model group， high-dose XJDHT significantly increased Bax/Bcl-2 ratio and PHGDH protein expression （P<0.01） and effectively reduced cell apoptosis （P<0.01） while down-regulating protein expressions of TNF-α， IL-1β， PKM2， and MTR （P<0.01）. Low-dose XJDHT moderately increased Bax/Bcl-2 ratio and PHGDH protein expression （P<0.05）， reduced apoptosis （P<0.05）， and decreased IL-1β and MTR protein levels （P<0.05， P<0.01）， but there were no significant changes in TNF-α and PKM2 expression. After PKM2 inhibition by shikonin in THP-1 cells， the expression of protein related to one-carbon metabolism was detected. Compared with the blank group， the LPS-induced model group showed significantly upregulated PKM2 and MTR protein expression （P<0.01） and downregulated PHGDH expression （P<0.01）. Compared with the model group， shikonin treatment significantly reduced PKM2 expression （P<0.05）， increased PHGDH expression （P<0.01）， and decreased MTR expression （P<0.05）. ConclusionXJDHT can inhibit the release of inflammatory factors in sepsis， and its mechanism is related to the intervention of the PKM2-regulated one-carbon metabolism pathway in macrophages.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

BACKGROUND: Generalized pustular psoriasis (GPP), a rare and recurrent autoinflammatory disease, imposes a substantial burden on patients and society. Awareness of GPP in China remains limited. METHODS: This cross-sectional survey, conducted between September 2021 and May 2023 across 14 hospitals in China, included GPP patients of all ages and disease phases. Data collected encompassed demographics, clinical characteristics, economic impact, disease severity, quality of life, and treatment-related complications. Risk factors for GPP recurrence were analyzed. RESULTS: Among 127 patients (female/male ratio = 1.35:1), the mean age of disease onset was 25 years (1st quartile [Q1]-3rd quartile [Q3]: 11-44 years); 29.2% had experienced GPP for more than 10 years. Recurrence occurred in 75.6% of patients, and nearly half reported no identifiable triggers. Younger age at disease onset ( P  = 0.021) and transitioning to plaque psoriasis ( P  = 0.022) were associated with higher recurrence rates. The median diagnostic delay was 8 months (Q1-Q3: 2-41 months), and 32.3% of patients reported misdiagnoses. Comorbidities were present in 53.5% of patients, whereas 51.1% experienced systemic complications during treatment. Depression and anxiety affected 84.5% and 95.6% of patients, respectively. During GPP flares, the median Dermatology Life Quality Index score was 19.0 (Q1-Q3: 13.0-23.5). This score showed significant differences between patients with and without systemic symptoms; it demonstrated correlations with both depression and anxiety scores. Treatment costs caused financial hardship in 55.9% of patients, underscoring the burden associated with GPP. CONCLUSIONS The substantial disease and economic burdens among Chinese GPP patients warrant increased attention. Patients with early onset disease and those transitioning to plaque psoriasis require targeted interventions to mitigate the high recurrence risk.
Humans ; Male ; Female ; Psoriasis/pathology* ; Adult ; Cross-Sectional Studies ; Adolescent ; Child ; Young Adult ; Quality of Life ; Middle Aged ; China/epidemiology* ; Recurrence ; Risk Factors ; Surveys and Questionnaires ; East Asian People

This study systematically reviewed the randomized controlled trial(RCT) of traditional Chinese medicine(TCM) treatment of post-stroke depression(PSD) and analyzed the clinical study characteristics and outcome indicators, aiming to optimize the design and establish the core outcome set in the future clinical trials of the TCM treatment of PSD. PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed were searched for the relevant RCT published in recent 3 years. The basic characteristics, intervention measures, and outcome indicators of the included RCT were extracted, and the descriptive analysis was carried out. A total of 76 RCTs were eventually included, with the sample size concentrated in 80-100 cases. The most frequent TCM syndromes were liver depression and Qi stagnation(15 times, 31.91%) and phlegm combined with stasis(5 times, 10.63%). The frequency of intervention methods followed a descending trend of TCM decoction(35 times, 46.05%) and TCM decoction + acupuncture(4 times, 5.26%), Chinese patent medicine(3 times, 3.94%), and the intervention mainly lasted for 1 to 3 months(43 times, 60.56%). The adverse reactions of patients were mainly digestive system reaction(150 patients, 39.37%) and nervous system reaction(112 patients, 29.39%). Most of the included studies had unclear risk of bias, involving 84 outcome indicators, which belonged to 8 indicator domains. The RCTs of TCM treatment of PSD showed a variety of problems, such as non-standard TCM syndrome differentiation, inconsistent names of TCM syndrome scores and measurement tools, low quality, unclear risk of bias, neglect of endpoint indicators, unreasonable selection of substitute indicators, lack of differentiation between primary and secondary outcome indicators, non-standard reporting of safety indicators, insufficient attention to economic indicators, and lack of long-term prognosis evaluation. It is suggested that the future research should improve the quality of methodology and build a standardized core outcome set to promote the development of high-quality clinical research in this field.
Humans ; Randomized Controlled Trials as Topic ; Drugs, Chinese Herbal/administration & dosage* ; Stroke/psychology* ; Depression/etiology* ; Treatment Outcome ; Medicine, Chinese Traditional

This study aims to explore the mechanism of Jiaotai Pills in treating depression based on metabolomics and network pharmacology. The chemical constituents of Jiaotai Pills were identified by UHPLC-Orbitrap Exploris 480, and the targets of Jiaotai Pills and depression were retrieved from online databases. STRING and Cytoscape 3.7.2 were used to construct the protein-protein interaction network of core targets of Jiaotai Pills in treating depression and the "compound-target-pathway" network. DAVID was used for Gene Ontology(GO) function and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analyses of the core targets. The mouse model of depression was established with chronic unpredictable mild stress(CUMS) and treated with different doses of Jiaotai Pills. The behavioral changes and pathological changes in the hippocampus were observed. UHPLC-Orbitrap Exploris 120 was used for metabolic profiling of the serum, from which the differential metabolites and related metabolic pathways were screened. A "metabolite-reaction-enzyme-gene" network was constructed for the integrated analysis of metabolomics and network pharmacology. A total of 34 chemical components of Jiaotai Pills were identified, and 143 core targets of Jiaotai Pills in treating depression were predicted, which were mainly involved in the arginine and proline, sphingolipid, and neurotrophin metabolism signaling pathways. The results of animal experiments showed that Jiaotai Pills alleviated the depression behaviors and pathological changes in the hippocampus of the mouse model of CUMS-induced depression. In addition, Jiaotai Pills reversed the levels of 32 metabolites involved in various pathways such as arginine and proline metabolism, sphingolipid metabolism, and porphyrin metabolism in the serum of model mice. The integrated analysis showed that arginine and proline metabolism, cysteine and methionine metabolism, and porphyrin metabolism might be the key pathways in the treatment of depression with Jiaotai Pills. In conclusion, metabolomics combined with network pharmacology clarifies the antidepressant mechanism of Jiaotai Pills, which may provide a basis for the clinical application of Jiaotai Pills in treating depression.
Animals ; Drugs, Chinese Herbal/chemistry* ; Depression/genetics* ; Mice ; Network Pharmacology ; Metabolomics ; Male ; Disease Models, Animal ; Humans ; Protein Interaction Maps/drug effects* ; Antidepressive Agents

This study aims to evaluate the efficacy of Chinese medicine injections in treating transient ischemic attack(TIA) based on network Meta-analysis. Randomized controlled trial(RCT) about Chinese medicine injections in treating TIA were retrieved from PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed with the time interval from inception to March 1, 2024. The methodological quality of the included articles was assessed by ROB 2.0, and the GRADE system was employed to evaluate the quality of evidence. The gemtc package of R 4.1.2 was used to perform the network Meta-analysis. Finally, 63 RCTs with a total sample size of 5 750 cases were included, involving 11 Chinese medicine injections(Shuxuetong Injection, Danhong Injection, Shuxuening Injection, Ginkgo Damo Injection, Shenxiong Glucose Injection, Ligustrazine Injection, Salviae Miltiorrhizae and Ligustrazine Hydrochloride Injection, Salvianolic Acids for Injection, Dengzhan Xixin Injection, Guhong Injection, and Xueshuantong Injection). All patients received conventional western medicine treatment, and the experimental group was additionally treated with Chinese medicine injection. Network Meta-analysis yielded the following results.(1) In terms of improving the clinical total response rate, 11 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Dengzhan Xixin Injection + conventional western medicine had the best effect.(2) In terms of reducing plasma viscosity, 7 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shenxiong Glucose Injection + conventional western medicine had the best effect.(3) In terms of reducing whole blood high shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Guhong Injection + conventional western medicine had the best effect.(4) In terms of reducing whole blood low shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect.(5) In terms of reducing fibrinogen, 9 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Ginkgo Damo Injection + conventional western medicine had the best effect.(6) In terms of increasing the average blood flow velocity, 3 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect. In summary, compared with conventional western medicine alone, Chinese medicine injections combined with conventional western medicine were effective in improving the clinical total response rate and the average blood flow velocity, as well as reducing plasma viscosity, whole blood high shear viscosity, whole blood low shear viscosity, and fibrinogen. However, due to the limited quality and quantity of the included articles, the above conclusions need to be verified by more high-quality, multi-center, and large-sample RCT.
Humans ; Drugs, Chinese Herbal/administration & dosage* ; Injections ; Ischemic Attack, Transient/drug therapy* ; Randomized Controlled Trials as Topic ; Treatment Outcome

Prostate cancer is the second most common malignancy and the sixth leading cause of cancer-related death in men worldwide. Radical prostatectomy (RP) is the standard treatment for localized prostate cancer, but the procedure often results in postoperative erectile dysfunction (ED). The poor efficacy of phosphodiesterase 5 inhibitors after surgery highlights the need to develop new therapies to enhance cavernous nerve regeneration and improve the erectile function of these patients. In the present study, we aimed to examine the potential of heparin-binding epidermal growth factor-like growth factor (HB-EGF) in preserving erectile function in cavernous nerve injury (CNI) mice. We found that HB-EGF expression was reduced significantly on the 1 st day after CNI in penile tissue. Ex vivo and in vitro studies showed that HB-EGF promotes major pelvic ganglion neurite sprouting and neuro-2a (N2a) cell migration. In vivo studies showed that exogenous HB-EGF treatment significantly restored the erectile function of CNI mice to 86.9% of sham levels. Immunofluorescence staining showed that mural and neuronal cells were preserved by inducing cell proliferation and reducing apoptosis and reactive oxygen species production. Western blot analysis showed that HB-EGF upregulated protein kinase B and extracellular signal-regulated kinase activation and neurotrophic factor expression. Overall, HB-EGF is a major promising therapeutic agent for treating ED in postoperative RP.
Animals ; Male ; Heparin-binding EGF-like Growth Factor/therapeutic use* ; Erectile Dysfunction/etiology* ; Mice ; Penis/drug effects* ; Nerve Regeneration/drug effects* ; Penile Erection/drug effects* ; Peripheral Nerve Injuries/drug therapy* ; Cell Proliferation/drug effects* ; Apoptosis/drug effects* ; Cell Movement/drug effects* ; Prostatectomy/adverse effects* ; Mice, Inbred C57BL ; Reactive Oxygen Species/metabolism*