Objective: To investigate the barrier membrane fixation performance and enhanced guided bone regeneration (GBR) capability of a thermosensitive adhesive containing bioactive glass nanoparticles in order to provide a novel solution for membrane fixation during GBR procedures. Methods: M2NP@BGN (methoxyethyl acrylate-co-N-isopropylacrylamide-co-protocatechuic acid@Bioactive glass nanoparticle), a thermosensitive adhesive, was synthesized via free radical polymerization by compositing methoxyethyl acrylate, N-isopropylacrylamide, and protocatechuic acid into a basic adhesive that was modified with bioactive glass nanoparticle (BGN). The successful fabrication of basic adhesive M2NP was characterized by attenuated total reflection-Fourier transform infrared spectroscopy and nuclear magnetic resonance spectroscopy. The thermosensitive adhesive M2NP@BGN (BGN concentration of 1 mg/mL) was characterized by scanning electron microscopy and a rheometer. By adjusting the BGN concentration (0.1 mg/mL, 0.5 mg/mL, 1 mg/mL, and 2 mg/mL), the adhesive and mechanical strengths were investigated with a universal testing machine. Biocompatibility was evaluated with a cell counting kit-8 assay and hemolysis test to identify the optimal formulation. The optimal material’s extract was co-cultured with mouse bone marrow mesenchymal stem cells, and its osteogenic activity was examined in vitro by quantitative real-time PCR, alkaline phosphatase, and alizarin red S staining. The rat mandibular defect model was established, filled with bone graft, and divided into 3 groups based on membrane fixation method: M2NP@BGN (BGN concentration of 1 mg/mL) fixation group (M2NP@BGN), titanium nail fixation group (Nail), and unfixed control group (Negative). Bone regeneration was analyzed after 8 weeks by micro computed tomography and histological staining. Results: M2NP@BGN (BGN concentration of 1 mg/mL) was successfully synthesized and demonstrated rapid gelation under warm, humid conditions. The adhesive with a BGN concentration of 1 mg/mL exhibited the highest adhesive strength (P < 0.001) and significantly enhanced mechanical strength (P < 0.001) under 37℃ wet conditions. All formulations showed excellent biocompatibility, with cell viability > 80% and hemolysis ratio < 5%. M2NP@BGN (BGN concentration of 1 mg/mL) significantly upregulated the expression of Runx2 and Col I (P < 0.001) and enhanced the activity of osteogenic differentiation markers (P < 0.05). In the animal model, the M2NP@BGN group (BGN concentration of 1 mg/mL) achieved significantly higher bone volume fraction and better bone maturity compared to the negative and nail groups (P < 0.05). Conclusion M2NP@BGN (BGN concentration of 1 mg/mL) combines excellent wet adhesion with potent osteogenic activity, enhances the bone augmentation efficacy of membranes, and presents a novel fixation strategy with significant clinical translation potential for GBR therapy.

Objective: To analyze the epidemiological characteristics and influencing factors of severe fever with thrombocytopenia syndrome (SFTS) in Zhejiang Province from 2019 to 2023, so as to provide the reference for strengthening SFTS prevention and control. Methods: Data on laboratory-confirmed SFTS cases in Zhejiang Province from 2019 to 2023 were collected through the Infectious Disease Reporting Information System of Chinese Disease Prevention and Control Information System. Meteorological data, geographic environment and socioeconomic factors during the same period were collected from the fifth-generation European Centre for Medium-Range Weather Forecasts, Geospatial Data Cloud, and Zhejiang Statistical Yearbook, respectively. Descriptive epidemiological methods were used to analyze the epidemiological characteristics of SFTS from 2019 to 2023, and a Bayesian spatio-temporal model was constructed to analyze the influencing factors of SFTS incidence. Results: A total of 578 SFTS cases were reported in Zhejiang Province from 2019 to 2023, with an annual average incidence of 0.23/105. The peak period was from May to July, accounting for 52.60%. There were 309 males and 269 females, with a male-to-female ratio of 1.15∶1. The cases were mainly aged 50-<80 years, farmers, and in rural areas, accounting for 82.53%, 77.34%, and 75.43%, respectively. Taizhou City and Shaoxing City reported more SFTS cases, while Shaoxing City and Zhoushan City had higher annual average incidences of SFTS. The Bayesian spatio-temporal interaction model showed good goodness of fit. The results showed that mean temperature (RR=1.626, 95%CI: 1.111-2.378) and mean wind speed (RR=1.814, 95%CI: 1.321-2.492) were positively correlated with SFTS risk, while altitude (RR=0.432, 95%CI: 0.230-0.829) and population density (RR=0.443, 95%CI: 0.207-0.964) were negatively correlated with SFTS risk. Conclusions SFTS in Zhejiang Province peaks from May to July. Middle-aged and elderly people and farmers are high-risk populations. Taizhou City, Shaoxing City, and Zhoushan City are high-incidence areas. Mean temperature, mean wind speed, altitude, and population density can all affect the risk of SFTS incidence.

Objective: To analyze the prevalence status and clustering patterns of risk factors for chronic diseases among adult residents in Rui' an City, Zhejiang Province, so as to provide a basis for formulating strategies for the prevention and control of chronic diseases and implementing risk factor interventions. Methods: A multi-stage random cluster sampling method was used to select residents aged ≥18 years in 5 townships (sub-districts) of Rui' an City as survey subjects from December 2023 to March 2024. Data on basic information, history of major chronic diseases, lifestyle behaviors, height, weight, and blood biochemical indicators were collected through questionnaire surveys, physical examinations, and laboratory tests. Descriptive analysis was used to analyze the prevalence status of 5 risk factors for chronic diseases. K-means clustering analysis was used to analyze clustering patterns. Results: A total of 3 060 people were surveyed, including 1 476 males, accounting for 48.24%, and 1 584 females, accounting for 51.76%. The median age was 49.00 (interquartile range, 25.00) years. There were 1 275 cases (41.67%) of hypertension, 462 cases (15.10%) of diabetes, and 1 460 cases (47.71%) of dyslipidemia. Insufficient fruit and vegetable intake, excessive salt intake, overweight and obesity, excessive red meat intake, and smoking involved 2 201, 1 878, 1 541, 1 337, and 571 people, with prevalences of 71.93%, 61.37%, 50.36%, 43.69%, and 18.66%, respectively. K-means clustering analysis identified 4 clustering patterns: smoking-insufficient fruit and vegetable intake type (249 people, accounting for 8.20%), low intake type (1 421 people, accounting for 46.75%). high red meat type (245 people, accounting for 8.07%), and high BMI-high salt type (1 118 people, accounting for 36.96%). The prevalences of hypertension and diabetes were higher in adult residents of the high BMI-high salt type, at 56.53% and 20.30%, respectively. The prevalence of dyslipidemia was higher in adult residents of the smoking-insufficient fruit and vegetable intake type, at 59.44%. Conclusions The prevalence of insufficient fruit and vegetable intake among adult residents in Rui' an City is relatively high. The clustering pattern of chronic disease risk factors is dominated by the low intake type. The prevalence of chronic diseases is higher in adult residents of the high BMI-high salt type and smoking-insufficient fruit and vegetable intake type. It is suggested to carry out health education and collaborative intervention of risk factors for different risk groups.

OBJECTIVE To investigate the use of drugs and the development of pharmaceutical care in the tight medical alliance （shorted for “medical alliance”） of Wanzhou District of Chongqing， and provide reference for the further construction of the medical alliance. METHODS A survey form was designed and distributed to 21 constituent units （5 leading units and 16 member units） of 5 medical alliances in Wanzhou District of Chongqing. The statistical analysis was conducted in aspects of basic drug allocation and use， pharmaceutical personnel team construction， the development of pharmaceutical care， and rational use of antibiotics. RESULTS Among the 21 constituent units， 4 leading units and 14 member units achieved the target for the proportion of essential drug procurement varieties， with a total compliance rate of 85.71%； 4 leading units and 13 member units achieved the target for the proportion of national essential drug allocation and usage amount， with a total compliance rate of 80.95%. The proportions of personnel with doctoral degrees in the 5 leading units and 16 member units were 1.71% and 0 respectively， and the proportions of personnel with senior professional titles were 8.56% and 1.63%， respectively. A total of 5 pharmacy or pharmaceutical combined outpatient clinics were set up in the 21 medical alliance units， and 5 clinical pharmacy information service platforms were established； all 5 leading units were able to regularly carry out clinical pharmacy projects， while only 4 out of 16 member units had conducted medical order review and evaluation. The proportions of irrational use of antibiotics in outpatient prescriptions and inpatient medical records of the 16 member units （4.81%， 5.21%） were significantly higher than those of the 5 leading units （2.80%， 4.00%）. CONCLUSIONS The allocation and usage of national essential drugs in 21 constituent units from Wanzhou District of Chongqing are both in good standing. However， the data on the allocation of pharmaceutical professionals and the number， qualifications， and job titles of clinical pharmacists in member units are generally low. Moreover， the pharmaceutical service projects and service quality in member units need to be further improved.

BACKGROUND:Multiple studies have confirmed that mitogen-activated protein kinase(MAPK)signaling pathway is involved in cell proliferation,and microRNA(miR)is involved in the occurrence and development of hypertrophic scars.Therefore,the role of miR-27a-3p and MAPK signaling pathways in pathological scar formation has been further explored. OBJECTIVE:To explore the effect of miR-27a-3p on the proliferation of human hypertrophic scar fibroblasts through the MAPK signaling pathway. METHODS:The primary fibroblasts were isolated and collected from the skin samples.The primary fibroblasts were observed by inverted microscope and verified by immunofluorescence.The relative expression level of miR-27a-3p in tissues was detected by qRT-PCR.The target genes of hsa-miR-27a-3p were predicted using the database,and then the predicted target genes were enriched by gene ontology function analysis and biological pathway enrichment analysis of the Kyoto Encyclopedia of Genes and Genomes.There were seven groups:blank control,negative control,miR-27a-3p mimic,miR-27a-3p inhibitor,miR-27a-3p mimic+p38 MAPK inhibitor,miR-27a-3p mimic+extracellular regulated protein kinase inhibitor,miR-27a-3p mimic+c-Jun N-terminal kinase inhibitor.Western blot was used to detect the levels of extracellular regulated protein kinase,c-Jun N-terminal kinase inhibitor.and p38 kinase and their phosphorylation levels.Cell counting kit-8 and EdU were used to detect cell proliferation. RESULTS AND CONCLUSION:Compared with normal skin fibroblasts,hypertrophic scar fibroblasts had stronger proliferative activity(P<0.05)and faster proliferation level(P<0.001).Compared with normal skin,miR-27a-3p was highly expressed in hypertrophic scars(P<0.001).Compared with the negative control group,overexpression of miR-27a-3p could promote cell proliferation activity(P<0.001)and proliferation levels(P<0.001).Compared with the negative control group,knockdown of miR-27a-3p could inhibit the proliferation activity(P<0.05)and proliferation levels(P<0.001).Compared with the negative control group,overexpression of miR-27a-3p promoted the phosphorylated levels of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 mitogen-activated protein kinase(P<0.05).Compared with the negative control group,knockdown of miR-27a-3p inhibited the phosphorylated levels of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 MAPK(P<0.05).Compared with the miR-27a-3p mimic group,specific inhibitors of extracellular regulated protein kinase,c-Jun N-terminal kinase,and p38 MAPK reversed the effects of miR-27a-3p on the proliferative activity(P<0.01)and proliferation level(P<0.001)of fibroblasts.To conclude,these results suggest that miR-27a-3p promotes the proliferation of human hypertrophic scar fibroblasts by activating the MAPK signaling pathway.

OBJECTIVE To explore the effects of CD20 coding gene （MS4A1） polymorphism on the blood concentration and efficacy of rituximab in patients with non-Hodgkin’s lymphoma. METHODS A prospective observational study was conducted on 160 newly diagnosed non-Hodgkin’s lymphoma patients who received the R-CHOP regimen at the Sun Yat Sen University Cancer Center from January 2016 to December 2020， with a minimum follow-up period of approximately 5 years. The blood concentration of rituximab was detected by enzyme-linked immunosorbent assay. MS4A1 tagSNPs were selected by Haploview4.2 software， including rs1051461， rs17155034， rs4939364， and rs10501385. The genotype of MS4A1 was detected by Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Univariate linear regression analysis was employed to examine the correlation between various factors（demographic， clinical， and genotypic variables） in patients and the steady-state trough concentration of rituximab during the first course of treatment， followed by multivariate linear regression analysis. Kaplan-Meier curves were drawn to evaluate progression-free survival （PFS） and overall survival （OS）. Using MS4A1 genotype and tumor stage as independent variables， Cox regression model was employed to evaluate the factors influencing patient prognosis. RESULTS The blood concentration of rituximab in MS4A1 rs10501385 CC carriers was 15.20 μg/mL，which was significantly lower than 21.95 μg/mL in AA+AC carriers （P＜0.05）. The multivariate linear regression model incorporating tumor stage and MS4A1 rs10501385 polymorphism explained 7.3% of the interindividual variability in rituximab concentrations. Compared with MS4A1 rs1051461 CC carriers， CT+TT carriers had significantly prolonged PFS and OS （P＜0.05）. The Cox proportional hazards regression model showed that the MS4A1 rs1051461 CC genotype （HR＝4.406， 95%CI：1.743-11.137， P＜0.05） and tumor Ⅲ&Ⅳ （HR＝3.233， 95%CI： 1.413-7.399， P＜0.05） were independent risk factors for PFS. CONCLUSIONS The tumor staging and MS4A1 rs10501385 polymorphism are key influencing factors for blood concentration of rituximab， and MS4A1 rs1051461 polymorphism significantly affects PFS in non-Hodgkin’s lymphoma patients.

To investigate the therapeutic effect and related mechanisms of hordenine on ovalbumin (OVA)-induced allergic rhinitis (AR) in rats, HE and AB-PAS staining were used to detect the improvement of pathological damage to the nasal mucosa induced by hordenine. ELISA was employed to detect the effect of hordenine on OVA-sIgE in serum and IL-4 in the nasal mucosa supernatant of rats. IHC and Western blot experiments were undertaken to examine the effect of hordenine on Th1/Th2 cell balance. Bioinformatics analysis was performed to predict pathways, which were verified by in vivo and in vitro experiments. The experimental results showed that hordenine could alleviate the behavioral manifestations of OVA-induced AR rats, alleviate nasal mucosal pathological damage caused by AR, and reduce the secretion of OVA-sIgE and IL-4. In addition, hordenine could regulate the Th1/Th2 balance. Bioinformatics analysis results showed that the potential pathway of action of hordenine on AR was the phosphoinositide 3 kinase (PI3K)/protein kinase B (Akt) signaling pathway. The in vivo experimental results showed that the expression of PI3K and p-Akt proteins in the nasal mucosa of the model group rats was significantly increased (P < 0.01), and that the protein expression level was significantly decreased after the administration of hordenine, which was also confirmed by an in vitro experiment. This study suggests that hordenine may regulate Th1/Th2 cell balance through the PI3K/Akt signaling pathway, thereby exerting an alleviating effect on OVA-induced AR.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Background: Intraoperative hypercapnia reduces the time to emergence from volatile anesthetics, but few clinical studies have explored the effect of hypercapnia on the emergence time from intravenous (IV) anesthesia. We investigated the effect of inducing mild hypercapnia during the recovery period on the emergence time after total IV anesthesia (TIVA). Methods: Adult patients undergoing transurethral lithotripsy under TIVA were randomly allocated to normocapnia group (end-tidal carbon dioxide [ETCO2] 35–40 mmHg) or mild hypercapnia group (ETCO2 50-55 mmHg) during the recovery period. The primary outcome was the extubation time. The spontaneous breathing-onset time, voluntary eye-opening time, and hemodynamic data were collected. Changes in the cerebral blood flow velocity in the middle cerebral artery were assessed using transcranial Doppler ultrasound. Results: In total, 164 patients completed the study. The extubation time was significantly shorter in the mild hypercapnia (13.9 ± 5.9 min, P = 0.024) than in the normocapnia group (16.3 ± 7.6 min). A similar reduction was observed in spontaneous breathing-onset time (P = 0.021) and voluntary eye-opening time (P = 0.008). Multiple linear regression analysis revealed that the adjusted ETCO2 level was a negative predictor of extubation time. Middle cerebral artery blood flow velocity was significantly increased after ETCO2 adjustment for mild hypercapnia, which rapidly returned to baseline, without any adverse reactions, within 20 min after extubation. Conclusions Mild hypercapnia during the recovery period significantly reduces the extubation time after TIVA. Increased ETCO2 levels can potentially enhance rapid recovery from IV anesthesia.

ObjectiveTo investigate the analgesic effect of Tuina at the "Weizhong （BL 40）" on neuropathic pain in a rat model of chronic constriction injury （CCI） of the sciatic nerve and its potential central spinal mechanisms. MethodsThirty-two Sprague-Dawley rats were randomly divided into four groups （8 rats in each group）， sham-operated group， model group， Tuina group， and blockade group. The CCI model was established in the model group， Tuina group， and the blockade group by ligating the sciatic nerve with catgut， while the sham-operated group underwent only sciatic nerve exposure without ligation. From postoperative day 4 to day 14， rats in the Tuina group and the blockade group received Tuina manipulation at the "Weizhong （BL 40）" using a dynamic pressure distribution measurement system （5 N pressure， 2 Hz frequency， 10 min per session， once daily）. The blockade group also received intraperitoneal injections of the microglial inhibitor minocycline （10 mg/kg） once daily. The sham-operated and the model group underwent the same handling and fixation as the Tuina group without actual Tuina. Mechanical withdrawal threshold （MWT） and paw withdrawal latency （PWL） were measured before surgery and on day 3， 7， 10， and 14 post-surgery. Transmission electron microscopy was used to evaluate sciatic nerve injury and repair， measuring axon diameter and total myelinated fiber diameter to calculate the g-ratio. Western Blotting was performed to detect the protein levels of ionized calcium-binding adapter molecule 1 （Iba-1）， CD206， CD68， interleukin-10 （IL-10）， and β-endorphin （β-EP） precursor pro-opiomelanocortin （POMC） in the ipsilateral spinal dorsal horn. ResultsCompared with the sham-operated group， the model group showed significantly reduced MWT and PWL on day 3， 7， 10， and 14 （P＜0.01）. Compared with the model group， the Tuina group and the blockade group showed increased MWT and PWL on day 10 and 14 （P＜0.05）. Compared with the Tuina group， the blockade group exhibited higher MWT on day 7， 10， and 14， and higher PWL on day 10 （P＜0.05）. Sciatic nerve pathological morphology revealed intact and well-structured myelin in the sham-operated group， while the model group exhibited myelin collapse， distortion， and myelin ovoid formation. The Tuina group displayed partially irregular myelin with occasional myelin collapse， whereas the blockade group exhibited partial myelin irregularities and phospholipid shedding. Compared with the sham-operated group， the model group showed a decreased g-ratio and increased levels of Iba-1 and CD68 in the spinal dorsal horn （P＜0.05 or P＜0.01）. Compared with the model group， the Tuina group and the blockade group exhibited an increased g-ratio and reduced Iba-1 and CD68 levels. Additionally， the Tuina group showed elevated levels of CD206， IL-10， and POMC， whereas the blockade group had decreased CD206 levels （P＜0.05）. ConclusionTuina at "Weizhong （BL 40）" alleviates neuropathic pain in CCI rats， potentially by regulating microglial activation in the spinal cord， inhibiting M1 polarization while promoting M2 polarization， and activating the IL-10/β-EP pathway to exert analgesic effects.