ObjectiveTo study the expression of interleukin-8 (IL-8) protein in villi and decidua of patients with recurrent spontaneous abortion(RSA). MethodsThe local and quantitative expressions of IL-8 in villi and decidua of 30 RSA patients were shown and measured by immunohistochemistry and Western blotting. Results IL-8 protein immunohistochemical signals were located in the chorioepithelium cytoplasm and decidual cells plasma in RSA group. While in control group the immunohistochemical staining was negative in decidul cells, but positive in glandular epithelium. The quantitative analysis of IL-8 protein by Western blotting, intensity of the immunostaining was higher in RSA group than that in the control group. Conclusion The higher expression of IL-8 in villi and decidua is releated to RSA, IL-8 might take part in the pathologic process of RSA.

Objective To construct prokaryotic expression plasmid of human recombinant soluble TNF-related apoptosis inducing ligand(rsTRAIL),then to investigate the effects of rsTRAIL on apoptosis in non-small cell lung carcinoma(NSCLC).Methods The encoding sequence for rsTRAIL was amplified with RT-PCR and cloned into PQE30 vector to establish the prokaryotic expression system.The competent cells of host strain of M15 were transformed by the recombinant plasmid.The expression of the target protein was induced with IPTG and purified by Ni2+-NTA agarose column.rsTRAIL was added in the media of A549 and H460wt cells,then the viability was examined by MTT assay.Apoptosis of H460wt cells was observed under fluorescence microscopy.The apoptotic rate of tumor cells was examined by FACS.Results The cloned fragment of rsTRAIL was 100% consistent with that reported in GenBank.The expressed protein with molecular weight of 21 000 in SDS-PAGE as expected was obtained and recognized by a commercial McAb.The apoptotic rate of H460wt cells after treated with rsTRAIL for 24 h was 43.2%.Cislatin enhanced the effect of rsTRAIL on A549 cells.Conclusion The rsTRAIL is obtained after Ni affinity chromatograph.rsTRAIL has a strong cytotoxic activity against NSCLC and cisplatin may enhance the antitumor effect of rsTRAIL.

Objective To construct a recombinant expression vector of human interleukin-24(hIL-24) gene and express it in E.coli M15,and to evaluate the bioactivity of IL-24 fusion protein.Methods The human IL-24 cDNA fragment was amplified from plasmid by polymerase chain reaction(PCR),and sequenced.PQE/hIL-24 was constructed by gene rearrangement,then it was transformed into E.coli M15.The expression of the target protein was induced with IPTG and purified by Ni2+-NTA agarose column.The expressed recombinant hIL-24(rhIL-24) was identified by SDS-PAGE and Western blotting.Normal peripheral blood mononuclear cells(PBMCs) were cultivated with the expression protein for 48 and 72 h,the levels of IL-6,IFN-? and TNF-? of PBMCs stimulated with rhIL-24 were detected by ELISA.Results The recombinant prokaryotic expression vector PQE/IL-24 was constructed successfully and expressed stably in E.coli M15.At about 18 400 of molecular weight,there was an induced protein band.The levels of IFN-?,IL-6 and TNF-? in the group of cultivated with the expression protein were obviously higher than those in the groups without the expresson protein(P

Objective To identify lesion patterns and stroke mechanisms in middle cerebral artery (MCA) territory using early diffusion-weighted imaging (DWI) combined with CTA as well as EKG and echocardiography.Methods One hundred and forty-eight acute ischemic stroke patients who had (1) symptomatic lesions located in the unilateral MCA territory on DWI performed within 1 week of symptom onset,and (2) either corresponding MCA disease,internal carotid artery (ICA) disease,MCA & ICA disease or cardio embolism (CE),or (3) neither corresponding MCA disease,ICA disease,nor CE which were taken as group of negative results (NR),were reviewed.Acute DWI lesion patterns were classified as (1) single (small perforator < 2 cm;large perforator ≥2 cm;pial;large territorial;border-zone) and (2) multiple according to principle of single-blind.Results There were 12 types of lesions in MCA territory.Distribution of lesion patterns in different stroke subtypes might be different (χ2= 55.88,P = 0.004).No specific pattern could be found in patients with MCA disease,ICA disease,MCA & ICA disease or CE.Big perforator infarcts might be more common in patients with MCA disease than with ICA disease and CE.Compared with negative group,concomitant perforator and pial infarcts were more common in patients with ICA disease (7/27,χ2=6.61,P <0.05),especially with severe stenosis or occlusion (5/16,χ2=7.32,P < 0.05);No specific pattern could be found in patients with MCA disease or CE.Concomitant perforator,pial,with border-zone infarcts (6/30,χ2= 6.41,P <0.05),and concomitant perforator with border-zone infarcts (4/30,χ2= 5.59,P < 0.05) were more often in patients with severe stenosis or occlusion of MCA.Conclusion Different lesion patterns may indicate different mechanisms of stroke such as hypoperfusion and arterial embolism could be coexistent in MCA territory.The relationship has not been identified perfectly.

[Abatract] In order to improve the result of clinical practice for undergraduate students of clinical medicine, combined with the professional characteristics of hematology and teaching syllabus, Hematology Department in the First Affiliated Hospital of Dalian Medical University developed practi-cal teaching content and tried using a variety of teaching methods and teaching means such as multi-media aided teaching, case teaching and simulation teaching method and so on. Besides, multiple station examination was established; teaching feedback and supervision were strengthened. The prac-tice proved that the reform measures were conducive to the cultivation of medical students' practical skills and clinical thinking, which helped to speed up the transformation from the students to the role of doctors.

Objective:To research rmIL-18 in vitro culture system CCs induce tumor-specific cytotoxic T lymphocytes CTL and anti-tumor effect in mice.Methods:Used Stem SepTM immune magnetic cells separation method to culture mouse spleen NK cells,T cells and DCs,established culture systems in vitro;used of different approaches,different doses rmIL-18 to immunize HCC tumor-bearing mice,researched the effect of rmIL-18 on tumor growth rate and survival time.Results:rmIL-18 could induce and promote tumor-specific CTL-mediated killing effects in vitro culture system;tumor-specific CTL could significantly inhibit tumor growth(P<0.01) of and prolong the survival time of liver cancer tumor-bearing mice(P<0.01),and the effect was increased with rmIL-18 concentration increased(P<0.01),and intratumoral injection was superior to intraperitoneal injection(P<0.01).Conclusion:rmIL-18 can induce tumor-specific CTL in vitro and play a role in anti-liver cancer in mice.

Objective:To investigate the effects of different doses and infusion methods of recombinant mouse interleukin-18(rmIL-18) on the survival time and tumor diameter of the mice with hepatocellular carcinoma,and to elucidate the rational application of rmIL-18 in vivo.Methods:A total of 60 Babl/C mice were randomly divided into 5 μg rmIL-18 intraperitoneal injection group,0.5 μg rmIL-18 intraperitoneal injection group,0.5 μg rmIL-18 tumor injection group,cytotoxic T lymphocyte(CTL) intraperitoneal injection group,CTL tumor injection group and saline control group;there were 10 mice in each group.From the 10th day of inoculation,the mice in different rmIL-18 groups were injected with the corresponding doses and methods.The mice in different CTL groups were injected with tumor-specific CTL (1×106/mouse) by intraperitoneal and intratumoral injection.The mice in saline control group were injected with an equal volume (100 μL) of saline,the injections were performed 10 times.The diameters of mice were measured weekly and the survival time was recorded.Results:Compared with 5 μg rmIL-18 intraperitoneal injection group,0.5 μg rmIL-18 intraperitoneal injection group and saline control group,the tumor growth rate of the mice in 0.5 μg rmIL-18 tumor injection group was decreased (P<0.01)and the survival rate of the mice was increased (P<0.01);compared with 0.5 μg rmIL-18 intraperitoneal injection group,the tumor growth rate and the survival rate of the mice in CTL intraperitoneal injection group were decreased (P<0.01);compared with 0.5 μg rmIL-18 tumor injection group,the tumor growth rate and the survival rate of the mice in CTL tumor injection group were decreased (P<0.01).Conclusion:The best way for rmIL-18 anti-tumor effect is tumor injection and the effect has a dose-dependent manner.

Objective To probe the relationship between the expression of TL1A and the level of IFN-γ secreted by T cells in the acute stage of Guillain-Barre syndrome (GBS). Methods ① Six-week female Bal b/c mice were immunized by purified recombinant human soluble TNF-like molecular 1A (rhsTL1A) protein. The polyclonal antibody against rhsTL1A was identified by immunofluorescence using human umbilical vein epithelial cells (HUVEC). ② To detect the biologic activity of rhsTL1A, the peripheral blood mononuclear cells (PBMC) from the healthy donors were separated by Ficoll gradient centrifugation and were seeded on 96-well plates with medium containing 2 μg/ml PHA (control group), 2 μg/ml PHA + 25 ng/ml rhsTL1 A, 2 μg/ml PHA + 100 ng/ml rhsTL1A and 2 μg/ml PHA + 400 ng/ml rhsTLlA respectively. T cell proliferation assay was carried out using ~3H-TdR. ③ IFN-γ productions in the sera of the children with GBS in the acute stage were detected by ELISA. ④ The ratio of CD_3~+ TL1A~+ T cells to CD_3~+ T cells in the peripheral blood of the children with GBS in acute stage was detected with flow, cytometry. ⑤PBMC from the children in acute GBS were separated and cultured in the environment adding 2 μg/ml PHA and 400 ng/ml rhsTL1A in vitro. Then, the IFN-γ in the supernatant was determined by ELISA kit after 72 hours. Results ① hTL1A A expressed by eukaryotic HUVECs was recognized by rhsTL1 A polyclonal antiserum. ② The result of T cell proliferation assay showed that SI of 25 ng/ml rhTL1A, 100 ng/ml rhTL1A A and 400 ng/ml rhTL1A group was increased compared with control group. The SI of 2 μg/ml PHA +400 ng/ml rhsTL1 A group was the highest (2. 65) among them. ③ IFN-γ productions in the sera of the children with GBS in the acute stage ((102. 25±22. 17) pg/ml) were increased significantly compared with healthy control ((28.75 ± 1.31) pg/ml, t = 3. 309, P < 0. 05). ④ The ratio of CD_3~+ TL1A~+ T cells to CD_3~+ T cells in the peripheral blood of the children with GBS in acute stage (18.22%± 1.83%) was enhanced significantly compared with healthy control (5. 17% ±0. 48%, t = 6. 884, P < 0. 01). ⑤ PBMC both in healthy control and the acute GBS secreted more IFN-γ markedly ((43.56± 4.41) pg/ml and (180.64 ± 38.39) pg/ml) after being incubated in 2 μg/ml PHA and 400 ng/ml rhsTL1A (t =4. 523 and 2. 600, P <0. 01 and 0. 05 respectively). Moreover, PBMC in acute GBS secreted more IFN-γ, than that of the healthy group markedly (t = 3. 545, P < 0. 05). Conclusions ① The mouse antiserum recognizing rhsTL1A is successfully obtained. ② In this study, 400 ng/ml rhsTL1A promotes the proliferation of T cells activated by 2 μg/ml PHA, indicating that rhsTL1A has biological activity. ③ The expression of hTL1A of activated T cells in the peripheral blood of the children with acute GBS is up-regulated. These TL1A proteins promote the secretion of IFN-γ through binding to their receptors DR_3.

Objective: To quantitatively measure biological parameters of nanophthalmos and analyze the correlation between axial length (AL) and the other biological parameters. Methods: The clinical data of 71 eyes of 43 patients identified with nanophthalmos (AL≤20 mm) from September 2012 to August 2018 in Zhongshan Ophthalmic Center were retrospectively analyzed.All enrolled patients underwent ophthalmological examinations including best-corrected visual acuity, refraction, slit-lamp biomicroscopy, fundus examination, Goldmann applanation tonometry, A-scan ultrasound examinations, ultrasound biomicroscopy, spectral domain optical coherence tomography (SD-OCT) and nonmydriatic fundus photography.Pearson correlation analysis was used to analyze the relationship between AL and all biological parameters.This study followed the Declaration of Helsinki and was approved by the Ethics Committee of Zhongshan Ophthalmic Center (NO.2017KYPJ092). All patients signed informed consent. Results: Of the 43 patients, the average age was (46.00±12.75) years, the mean intraocular pressure was (24.97±14.87)mmHg (1 mmHg=0.133 kPa). The mean best corrected visual acuity was 1.14±0.79, the mean refraction was (11.61±4.09)D.The mean AL, central corneal thickness (CCT), central anterior chamber depth(ACD), anterior chamber width (ACW), len thickness(LT) and vitreous cavity length(VCL) was (17.13±1.57)mm, (550±60)μm, (1.64±0.37)mm, (11.17±0.61)mm, (5.01±0.51)mm and (10.10±1.80)mm, respectively.The average retinal nerve fiber layer thickness (mRNFLT), macular foveal retinal thickness (FRT) and subfoveal choroidal thickness (SFCT) was (98.51±40.93), (294.46±116.83) and (488.72±133.06)μm, respectively.The ratio of ACD to AL, LT to AL, and VCL to AL was 9.6%, 29.4% and 59.3%, respectively.The ACW and VCL were positively correlated with AL(r=0.432, 0.978; both at P<0.001); whereas, LT and FRT were negatively correlated with AL(r=-0.272, P=0.027; r=-0.679, P<0.001). There was no correlation between CCT, central ACD, mRNFLT, SFCT and AL (r=0.153, -0.053, -0.322, 0.063; all at P>0.05). Conclusions Nanophthalmos has the characteristics of narrow anterior and posterior segment structure.The ratio of LT to AL is increased and the ratio of VCL to AL is decreased.The AL is positively correlated with ACW and VCL, negatively correlated with LT and FRT.

Objective To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia .Method A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing .The enrollment criteria were faculty member of the hospital with signed consent .The exclusion criteria were tumor , previous renal diseases , renal function damage , pregnancy , currently taking medicines that could increase or decrease serum uric acid level , and those who had gout.Males with serum uric acid >416.4 μmol/L and females with serum uric acid >359.6 μmol/L were enrolled as hyperuricemia group .Subjects with normal serum uric acid were randomly enrolled at 1:2 ratio after matching for gender , age, renal function and body mass index .Rs2231142( C>A) was assayed by amplification refractory mutation system polymerase chain reaction , with common forward primer:5′GGCTTTGCAGACATCTATGG 3′, C specific reverse primer:5′CGAAGAGCTGCTGAGAAATG 3′, and A specific reverse primer:5′CGAAGAGCTGCTGAGAAATT 3′.Association between rs 2231142 and hyperuricemia was analyzed in the general study group , as well as different gender and age groups .Results A total of 198 subjects with hyperuricemia and 370 controls were enrolled .The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001).After adjustment for hypertension, hyperglycemia and dyslipidemia , the OR was 2.99 (95%CI 1.94 -4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female.In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female.While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females.Interaction study between gender and rs 2231142 did not reach significant level in both the gender group and two age groups . Conclusion Single nucleotide polymorphism rs 2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort .The ORs are higher in male than those in female , especially in those less than 55 years old .