Herein, we report a case in which cholestasis caused discrepancy in high-density lipoprotein (HDL)-cholesterol levels measured using various methods. The discrepancy in HDL-cholesterol level originated from the abnormal increase in the level of an unusual lipoprotein, apo E-rich HDL, in the patient's serum. An abnormal slow alpha-migrating lipoprotein was observed on agarose gel electrophoresis, and an abnormal large-sized HDL was observed in a lipoprotein subfraction study. The level of apolipoprotein E was elevated.
Apolipoproteins ; Cholestasis ; Electrophoresis, Agar Gel ; Lipoproteins

Herein, we report a case in which cholestasis caused discrepancy in high-density lipoprotein (HDL)-cholesterol levels measured using various methods. The discrepancy in HDL-cholesterol level originated from the abnormal increase in the level of an unusual lipoprotein, apo E-rich HDL, in the patient's serum. An abnormal slow alpha-migrating lipoprotein was observed on agarose gel electrophoresis, and an abnormal large-sized HDL was observed in a lipoprotein subfraction study. The level of apolipoprotein E was elevated.
Apolipoproteins ; Cholestasis ; Electrophoresis, Agar Gel ; Lipoproteins

BACKGROUND: Recently biphasic agarose gel electrophoresis method using Chol/Trig ComboTM for simultaneous detection of cholesterol and triglyceride on lipoprotein fractions has been developed to facilitate the classification and interpretation of abnormal lipoprotein patterns of patients with hyperlipidemia. The author analysed serum lipid profiles using Chol/Trig ComboTM in the patients of OPD in Department of Internal Medicine. METHODS: Measurement of serum cholesterol and triglyceride using enzymatic method was performed in the sera of 415 patients from April, 2006 to July, 2006. Simultaneously, we electrophoresed serum cholesterol and triglyceride using Chol/Trig ComboTM with analysis software (ED BANK, Helena Laboratories, Saitama, Japan). RESULTS: According to ATP III guideline, we set up standard cholesterol as 200 mg/dL and triglyceride as 150 mg/dL, respectively, and the patients were classified into control, hypercholesterolemic, hypertriglyceridemic and hypercholesterolemic/hypertriglyceridemic groups, respectively. Hypercholesterolemic group had higher HDL and LDL, hypertriglyceridemic group had higher HDL, VLDL and the rates of positive modified LDL, hypercholesterolemic/hypertriglyceridemic group have higher VLDL and the rates of positive modified LDL than the control. Otherwise, the rates of positive modified LDL were 19.8% in the control, 23.6% in the hypercholesterolemic group, 50.9% in hypertriglyceridemic group, and 39.3% in hypercholesterolemic/hypertriglyceridemic group. CONCLUSIONS: The frequency of the rates of positive modified LDL and VLDL was higher in the hypertriglyceridemic group than those in the control.
Adenosine Triphosphate ; Cholesterol ; Electrophoresis ; Electrophoresis, Agar Gel ; Humans ; Hyperlipidemias ; Lipoproteins

BACKGROUND: Recently biphasic agarose gel electrophoresis method using Chol/Trig ComboTM for simultaneous detection of cholesterol and triglyceride on lipoprotein fractions has been developed to facilitate the classification and interpretation of abnormal lipoprotein patterns of patients with hyperlipidemia. The author analysed serum lipid profiles using Chol/Trig ComboTM in the patients of OPD in Department of Internal Medicine. METHODS: Measurement of serum cholesterol and triglyceride using enzymatic method was performed in the sera of 415 patients from April, 2006 to July, 2006. Simultaneously, we electrophoresed serum cholesterol and triglyceride using Chol/Trig ComboTM with analysis software (ED BANK, Helena Laboratories, Saitama, Japan). RESULTS: According to ATP III guideline, we set up standard cholesterol as 200 mg/dL and triglyceride as 150 mg/dL, respectively, and the patients were classified into control, hypercholesterolemic, hypertriglyceridemic and hypercholesterolemic/hypertriglyceridemic groups, respectively. Hypercholesterolemic group had higher HDL and LDL, hypertriglyceridemic group had higher HDL, VLDL and the rates of positive modified LDL, hypercholesterolemic/hypertriglyceridemic group have higher VLDL and the rates of positive modified LDL than the control. Otherwise, the rates of positive modified LDL were 19.8% in the control, 23.6% in the hypercholesterolemic group, 50.9% in hypertriglyceridemic group, and 39.3% in hypercholesterolemic/hypertriglyceridemic group. CONCLUSIONS: The frequency of the rates of positive modified LDL and VLDL was higher in the hypertriglyceridemic group than those in the control.
Adenosine Triphosphate ; Cholesterol ; Electrophoresis ; Electrophoresis, Agar Gel ; Humans ; Hyperlipidemias ; Lipoproteins

BACKGROUND: Polymerase chain reacation (PCR)-based methods have been described for rapid detection and identification of Candida spp. Multiplex PCR assay was developed using internal transcribed spacers and topoisomerase II gene for the accurate identification of Candida species. METHODS: We designed Dual Specificity Oligo (DSO) primers for multiplex PCR. Multiplex PCR was followed by agarose gel electrophoresis to test 8 type strains (C. albicans, C. parapsilosis, C. glabrata, C. tropicalis, C. krusei, C. guilliermondii, C. lusitaniae, C. dubliniensis) and 96 clinical isolates (C. albicans 51 isolates, C. parapsilosis 10 isolates, C. glabrata 10 isolates, C. tropicalis 9 isolates, C. krusei 6 isolates, C. guilliermondii 5 isolates, C. lusitaniae 5 isolates) of Candida spp. RESULTS: With multiplex PCR using DSO primers, the eight Candida type strains each could be easily differentiated and all 96 clinical isolates were identified as the same species as were identified by the conventional method. CONCLUSION: Multiplex PCR followed by electrophoresis can be useful for the simple and rapid identification of Candida species in routine laboratories.
Candida* ; DNA Topoisomerases, Type II ; Electrophoresis ; Electrophoresis, Agar Gel ; Multiplex Polymerase Chain Reaction* ; Sensitivity and Specificity

OBJECTIVETo analyse clinical feasibility of two electrophoresis procedures of seminal plasma proteins, agarose gel electrophoresis and SDS-agarose gel electrophoresis.

METHODSSixty-nine semen samples were examined and classified into three groups: the asthenozoospermia (n = 22), the asthenoteratozoospermia (n = 19), and the relative normal group (n = 28) with normal routine and special test results, according to WHO routine and special test criterion. Then, the seminal plasma protenis were separated by two different electrophoresis, with SDS-agarose and agarose support medium, the buffer pH 7.0 and 9.2 respectively. The agarose gel electrophoresis was done under various sample loading time, motion power and staining modules. The completed gels were scanned and compared the each other statistically.

RESULTSSeminal plasma proteins can be separated into 4 strips by SDS-agarose gel electrophoresis with acid crystal violet, and the strips were diffusion and with dark background. However, 6 clear strips named A, B, C, D, E, and F can be obtained by agarose gel electrophoresis with 6 min. After samples were loaded and stained by amidoblack, there showed appropriate spaces among strips, and it was very easy to scan the drying gel by a densitometer. Using agarose gel electrophoresis, the statistical difference in strip C and E was shown between the asthenozoospermia and the relative normal group, and between the asthenozoospermia and the asthenoteratozoospermia, however, not between the relative normal and the asthenoteratozoospermia group. Moreover, the samples in the relative normal group with normal routine and special test results were in different electrophoresis maps.

CONCLUSIONAgarose gel electrophoresis of seminal plasma proteins with buffer pH 9.2, 6 min. sample loading and amidoblack stain was a simple, fast and fit technique for clinic.

Adult ; Electrophoresis, Agar Gel ; methods ; Electrophoresis, Polyacrylamide Gel ; methods ; Humans ; Male ; Proteins ; analysis ; Semen ; chemistry ; Staining and Labeling

BACKGROUND: Methicillin-resistant Staphylococcus aureus (MRSA) has a heteroresistant nature, so methicillin resistance is influenced by various culture conditions, such as temperature, incubation time, and NaCl content in the medium. Mueller Hinton (MH) agar containing 2% NaCl and mannitol salt agar (MSA) with oxacillin disk were evaluated for the detection of methicillin resistance. METHODS: Disk diffusion test on plain Mueller- Hinton (MH) agar, 2% NaCl MH agar, and MSA with 1 microgram oxacillin disk was performed in 70 Stap hylococcus aureus isolates. Oxacillin MIC was determined by E-test. As a gold standard of methicillin resistance, mecA gene was amplified by PCR and detected by agarose gel electrophoresis. RESULTS: Plain MH agar could not detect heterogeneous resistance in 12 S. aureus isolates (18%), but 2% NaCl MH agar and MSA could correctly detect homogeneous and heterogeneous resistance. S. aureus isolates from stool have as much as 48% heterogeneous resistance, while those from non-stool specimen have 5%. CONCLUSION: 2% NaCl and MSA can be used reliably for accurate susceptibility testing of methicillin resistance in routine laboratory.
Agar* ; Diffusion ; Electrophoresis, Agar Gel ; Mannitol* ; Methicillin Resistance* ; Methicillin* ; Methicillin-Resistant Staphylococcus aureus ; Oxacillin ; Polymerase Chain Reaction ; Staphylococcus aureus* ; Staphylococcus*

BACKGROUND: Currently, several different apolipoprotein E (apo E) genotyping methods have been developed. The Amplification Refractory Mutation System (ARMS) apo E genotyping, as previously described, requires four separate PCR reactions. The purpose of this study is to determine the clinical usefulness of the multiplex ARMS apo E genotyping with the use of only two PCR reactions. METHODS: We used five primers and two separate PCR reactions to detect the apo E polymorphism by using the multiplex ARMS technique. Apo E genotyping was performed with both the multiplex ARMS and INNO-LiPATM Apo E kit (INNOGENETICS) in 122 random samples. We investigated the effect of dimethyl sulfoxide (DMSO) in the multiplex ARMS PCR with various DMSO concentrations (0-15%). RESULTS: All six possible genotypes for apo E were clearly discernible with the multiplex ARMS. The apo E genotypes determined by the two methods were in complete agreement with all 122 samples. We found that DMSO is essential for the successful amplification of the multiplex ARMS and DMSO at concentrations of 3%-7% to be the optimal concentration. CONCLUSIONS: ARMS analysis involves two stages: PCR and agarose gel electrophoresis. Apo E genotyping using the multiplex ARMS requires only two PCR reactions. Thus, because of its simplicity, speed, accuracy, and cost-effectiveness, this method may be appropriate for determining the apo E genotypes in routine clinical laboratories.
Apolipoproteins E ; Apolipoproteins* ; Arm ; Dimethyl Sulfoxide ; Electrophoresis, Agar Gel ; Genotype ; Polymerase Chain Reaction

The rapid and sensitive diagnostic methods for herpes simplex virus (HSV) infection have been developed. In this study, we employed the polymerase chain reaction (PCR) technique with primer 5 CATCACCGACCCGGAGACGGAC 3 for detection HSV DNA from specimens obtained from the corneal lesion of patients who were suspected of HSV keratitis. The products of PCR was confirmed with agarose gel electrophoresis and southern blot hybridization. Positive results were obtained 4 of 7 typical lesions(2 of 5 dendritic lesions and 2 of 2 geographic lesions) and 7 including 4 without a history of herpetic keratitis of 17 atypical lesions. With these results we could find that PCR technique would be a useful tool for the detection of HSV DNA in both typical and atypical lesion of herpetic keratitis as well as in cases hard to diagnose clinically.
Blotting, Southern ; DNA ; Electrophoresis, Agar Gel ; Herpes Simplex* ; Humans ; Keratitis ; Keratitis, Herpetic ; Polymerase Chain Reaction ; Simplexvirus*

BACKGROUND: The determination of apo E polymorphism through the phenotyping is not suitable for large studies in the clinical laboratories because of various problems. So apo E genotyping has been developed. We present a method of apo E genotyping using a modified amplification refractory mutation system(ARMS) technique. METHODS: We used four primers to detect the region containing two mutation points coding amino acid residues 112 and 158 and have developed a method of apo E genotyping by the modified ARMS technique. Apo E genotyping were performed by both the modified ARMS technique and the INNO-LiPA Apo E kit(Innogenetics, Belgium) with the following frequency distribution: Epsilon2/2(n=10), Epsilon3/3(n=15), Epsilon4/4(n=7), Epsilon2/3(n=9), Epsilon2/4(n=12), Epsilon3/4(n=13). RESULTS: All the samples gave the correct and clear amplification patterns. Modified ARMS correctly distinguished among the six apo E genotypes. The apo E genotypes determined by both methods for every specimen studied were in complete agreement. CONCLUSIONS: This modified ARMS technique involved only two stages: PCR and agarose gel electrophoresis. Since apo E genotyping by the modified ARMS is reliable, simple to perform, less time consuming, and not expensive, we conclude that it is suitable for large sample studies in the clinical laboratories.
Apolipoproteins E ; Apolipoproteins* ; Arm* ; Clinical Coding ; Electrophoresis, Agar Gel ; Genotype ; Polymerase Chain Reaction*