1.Clinical, metabolic, and autoimmune characteristics of newly diagnosed young Filipino adults with diabetes mellitus.
Elizabeth Paz-Pacheco ; Angelique Bea C. Uy ; Angelique Love Tiglao-Gica ; Anna Elvira S. Arcellana ; Aura Bree Dayo-Lacdao ; Cynthia P. Cordero ; Cecilia A. Jimeno ; Ma. Cecille Añ ; onuevo-Cruz ; Noel R. Juban
Acta Medica Philippina 2026;60(2):41-49
OBJECTIVES
In Asia, younger individuals (below age 45) are diagnosed to have type 2 diabetes with increased rates of obesity defined by lower BMI yet with greater visceral adiposity (waist circumference and waisthip ratios). The prevalence data on type 1 diabetes is not well established, considered to be low, but is seen to be increasing as well. This changing phenotype therefore, presents a clinical dilemma in terms of correctly classifying diabetes and deciding on the consequent appropriate treatment. Distinguishing type 1 from type 2 diabetes has become more difficult with type 2 diabetes dramatically increasing in young adults and children. This study aims to define the characteristics of diabetes among young adults in the Philippines to provide a basis for appropriate management amidst changes in diabetes phenotypes seen globally.
METHODSIn this cross-sectional analytic study, we characterized the demographic, metabolic, and autoimmune features of diabetes among young adult Filipinos aged 18 to 45 years old consulting at a tertiary referral center in Manila, Philippines. Baseline serum A1c, FBS, 75-g oral glucose tolerance test, insulin, serum C-peptide, insulin autoantibodies, leptin, adiponectin, lipid profile, and thyroid function tests were obtained from the participants and analyzed. The homeostasis model assessment (HOMA) was used to estimate the insulin sensitivity.
RESULTSA total of 348 patients with diabetes were included, with females comprising two-thirds of the participants. The mean age at diagnosis of diabetes was 35.9±7.22 years. The mean BMI was 28.12 kg/m2, with median waist to hip ratio (WHR) of 0·93. Metabolic syndrome was found in 60% of participants and 67.82% were obese by body mass index. The mean A1c was 9.07±2.52%. Good glucose control (A1c less than 7.0%) was seen in 23% of participants while nearly half (48%) had HbA1c which was >9.0%. The median levels of fasting insulin and C-peptide were 12.62 (range 1.33–90.42) mIU/L and 0.78 ng/mL (range 0–16.2), respectively.
Included participants were diagnosed with diabetes within a year and as such, majority did not have any micro- or macrovascular complications. The most common diabetes complication was sensory neuropathy detected by monofilament testing, which was found in 28% of participants, followed by non-proliferative diabetic retinopathy in 13%. A history of previous diabetic ketoacidosis was found in 10 patients (2.87%). Glutamic acid decarboxylase (GAD) and insulin auto-antibodies were found in 3.2% and 19.3% of participants, respectively. Approximately half (51.73%) of the participants were insulin resistant by HOMA-IR.
CONCLUSIONIn contrast with Caucasians and other Asians, diabetes among young Filipino adults is associated with lower BMI but with a similarly high visceral adiposity as shown by an elevated WHR. Metabolic syndrome with insulin resistance as defined by a variety of indices is predominant. Type 1 diabetes with autoantibodies occur in only a small fraction of this population. Data derived from this work can provide a framework for cluster analysis towards personalized management specific to this population.
Human ; Acids ; Adiponectin ; Adiposity ; Adult ; Aged ; Antibodies ; Asia ; Asian ; Asian Continental Ancestry Group ; Autoantibodies ; Body Mass Index ; C-peptide ; Carboxy-lyases ; Child ; Cluster Analysis ; Demography ; Diabetes Complications ; Diabetes Mellitus ; Diabetes Mellitus, Type 1 ; Diabetes Mellitus, Type 2 ; Diabetic Ketoacidosis ; Diabetic Retinopathy ; Diagnosis ; Fasting ; Female ; Glucose ; Glucose Tolerance Test ; Glutamate Decarboxylase ; Glutamic Acid ; Insulin ; Insulin Resistance ; Ketosis ; Leptin ; Lipids ; Metabolic Syndrome ; Obesity ; Patients ; Peptides ; Phenotype ; Philippines ; Population ; Prevalence ; Serum ; Therapeutics ; Thyroid Gland ; Thyroid Function Tests ; Young Adult
2.Predicting Diabetic Retinopathy Using a Machine Learning Approach Informed by Whole-Exome Sequencing Studies.
Chong Yang SHE ; Wen Ying FAN ; Yun Yun LI ; Yong TAO ; Zu Fei LI
Biomedical and Environmental Sciences 2025;38(1):67-78
OBJECTIVE:
To establish and validate a novel diabetic retinopathy (DR) risk-prediction model using a whole-exome sequencing (WES)-based machine learning (ML) method.
METHODS:
WES was performed to identify potential single nucleotide polymorphism (SNP) or mutation sites in a DR pedigree comprising 10 members. A prediction model was established and validated in a cohort of 420 type 2 diabetic patients based on both genetic and demographic features. The contribution of each feature was assessed using Shapley Additive explanation analysis. The efficacies of the models with and without SNP were compared.
RESULTS:
WES revealed that seven SNPs/mutations ( rs116911833 in TRIM7, 1997T>C in LRBA, 1643T>C in PRMT10, rs117858678 in C9orf152, rs201922794 in CLDN25, rs146694895 in SH3GLB2, and rs201407189 in FANCC) were associated with DR. Notably, the model including rs146694895 and rs201407189 achieved better performance in predicting DR (accuracy: 80.2%; sensitivity: 83.3%; specificity: 76.7%; area under the receiver operating characteristic curve [AUC]: 80.0%) than the model without these SNPs (accuracy: 79.4%; sensitivity: 80.3%; specificity: 78.3%; AUC: 79.3%).
CONCLUSION
Novel SNP sites associated with DR were identified in the DR pedigree. Inclusion of rs146694895 and rs201407189 significantly enhanced the performance of the ML-based DR prediction model.
Diabetic Retinopathy/diagnosis*
;
Humans
;
Machine Learning
;
Male
;
Female
;
Polymorphism, Single Nucleotide
;
Middle Aged
;
Exome Sequencing
;
Aged
;
Adult
;
Pedigree
;
Diabetes Mellitus, Type 2/complications*
;
Genetic Predisposition to Disease
;
Mutation
3.Research on type 2 diabetes prediction algorithm based on photoplethysmography.
Mingying HU ; Quanyu WU ; Yifan CAO ; Jin CAO ; Yifan ZHAO ; Lin ZHANG ; Xiaojie LIU
Journal of Biomedical Engineering 2025;42(5):1005-1011
To address the current issues of data imbalance and scarcity in photoplethysmography (PPG) data for type 2 diabetes mellitus (T2DM) prediction, this study proposes an improved conditional Wasserstein generative adversarial network with gradient penalty (CWGAN-GP). The algorithm integrated gated recurrent unit (GRU) networks and self-attention mechanisms to construct a generator, aiming to produce high-quality PPG signals. Various data augmentation methods, including the improved CWGAN-GP, were employed to expand the PPG dataset, and multiple classifiers were applied for T2DM prediction analysis. Experimental results showed that the model trained on data generated by the improved CWGAN-GP achieved the optimal prediction performance. The highest accuracy reached 0.895 0, and compared with other data enhancement methods, this approach exhibited significant advantages in terms of precision and F1-score. The generated data notably enhances the accuracy and generalization ability of T2DM prediction models, providing a more reliable technical basis for non-invasive early T2DM screening based on PPG signals.
Photoplethysmography/methods*
;
Diabetes Mellitus, Type 2/diagnosis*
;
Humans
;
Algorithms
;
Neural Networks, Computer
;
Signal Processing, Computer-Assisted
;
Prediction Algorithms
4.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
5.Application of salivary micro-ecosystem in early prevention and control of oral and systemic diseases.
Xiangyu SUN ; Chao YUAN ; Xinzhu ZHOU ; Jing DIAO ; Shuguo ZHENG
Journal of Peking University(Health Sciences) 2025;57(5):859-863
Saliva is an important body fluid in the oral cavity containing lots of biomarkers, whose inherent micro-ecosystem holds significant value for early diagnosis and monitoring of oral diseases. Simultaneously, saliva has particular advantages, such as ease of sampling, painless and non-invasive collection, and suitability for repeated sampling, making it highly appropriate for surveillance and follow-up of diseases. In a series of studies conducted by the research group for preventive dentistry in Peking University School and Hospital of Stomatology, we compared different segments of saliva and those samples collected via different sampling methods using proteomic/peptidomic and microbiomic technologies to explore the stability of saliva samples. Besides, the significance of applying representative salivary biomarkers in early prevention and control of representative oral diseases (e.g. dental caries, periodontal diseases) and systemic conditions (e.g. type 2 diabetes mellitus, chronic kidney disease) was confirmed as well.
Humans
;
Saliva/chemistry*
;
Dental Caries/diagnosis*
;
Biomarkers/analysis*
;
Periodontal Diseases/diagnosis*
;
Mouth Diseases/diagnosis*
;
Proteomics/methods*
;
Diabetes Mellitus, Type 2/diagnosis*
;
Microbiota
;
Renal Insufficiency, Chronic/prevention & control*
6.Cardiac Structural and Functional Features in Patients With Type 2 Diabetes Mellitus and Heart Failure With Preserved Ejection Fraction:A Study Based on Propensity Score Matching.
Ke-Ling PENG ; Yong-Ming LIU ; Xiao-Yan JIA ; Hua WANG ; Chun-Li GOU ; Li-Li XUE ; Quan ZOU ; Wen-Jun ZHANG
Acta Academiae Medicinae Sinicae 2023;45(2):264-272
Objective To investigate the cardiac structural and functional characteristics in the patients with heart failure with preserved ejection fraction (HFpEF) and type 2 diabetes mellitus (T2DM),and predict the factors influencing the characteristics. Methods A total of 783 HFpEF patients diagnosed in the Department of Geriatric Cardiology,the First Hospital of Lanzhou University from April 2009 to December 2020 were enrolled in this study.Echocardiography and tissue Doppler technique were employed to evaluate cardiac structure and function.According to the occurrence of T2DM,the patients were assigned into a HFpEF+T2DM group (n=332) and a HFpEF group (n=451).Propensity score matching (PSM)(in a 1∶1 ratio) was adopted to minimize confounding effect.According to urinary albumin excretion rate (UAER),the HFpEF+T2DM group was further divided into three subgroups with UAER<20 μg/min,of 20-200 μg/min,and>200 μg/min,respectively.The comorbidities,symptoms and signs,and cardiac structure and function were compared among the groups to clarify the features of diabetes related HFpEF.Multivariate linear regression was conducted to probe the relationship of systolic blood pressure,blood glucose,glycosylated hemoglobin,and UARE with cardiac structural and functional impairment. Results The HFpEF+T2DM group had higher prevalence of hypertension (P=0.001) and coronary heart disease (P=0.036),younger age (P=0.020),and larger body mass index (P=0.005) than the HFpEF group,with the median diabetic course of 10 (3,17) years.After PSM,the prevalence of hypertension and coronary heart disease,body mass index,and age had no significant differences between the two groups(all P>0.05).In addition,the HFpEF+T2DM group had higher interventricular septal thickness (P=0.015),left ventricular posterior wall thickness (P=0.040),and left ventricular mass (P=0.012) and lower early diastole velocity of mitral annular septum (P=0.030) and lateral wall (P=0.011) than the HFpEF group.Compared with the HFpEF group,the HFpEF+T2DM group showed increased ratio of early diastolic mitral filling velocity to early diastolic mitral annular velocity (E/e') (P=0.036).Glycosylated hemoglobin was correlated with left ventricular mass (P=0.011),and the natural logarithm of UAER with interventricular septal thickness (P=0.004),left ventricular posterior wall thickness (P=0.006),left ventricular mass (P<0.001),and E/e' ratio (P=0.049). Conclusion The patients with both T2DM and HFpEF have thicker left ventricular wall,larger left ventricular mass,more advanced left ventricular remodeling,severer impaired left ventricular diastolic function,and higher left ventricular filling pressure than the HFpEF patients without T2DM.Elevated blood glucose and diabetic microvascular diseases might play a role in the development of the detrimental structural and functional changes of the heart.
Humans
;
Aged
;
Heart Failure/diagnosis*
;
Diabetes Mellitus, Type 2
;
Stroke Volume
;
Glycated Hemoglobin
;
Blood Glucose
;
Propensity Score
;
Ventricular Function, Left
;
Hypertension
7.Salivary biomarkers: novel noninvasive tools to diagnose chronic inflammation.
Paola DONGIOVANNI ; Marica MERONI ; Sara CASATI ; Riccardo GOLDONI ; Douglas Vieira THOMAZ ; Nermin Seda KEHR ; Daniela GALIMBERTI ; Massimo DEL FABBRO ; Gianluca M TARTAGLIA
International Journal of Oral Science 2023;15(1):27-27
Several chronic disorders including type 2 diabetes (T2D), obesity, heart disease and cancer are preceded by a state of chronic low-grade inflammation. Biomarkers for the early assessment of chronic disorders encompass acute phase proteins (APP), cytokines and chemokines, pro-inflammatory enzymes, lipids and oxidative stress mediators. These substances enter saliva through the blood flow and, in some cases, there is a close relation between their salivary and serum concentration. Saliva can be easily collected and stored with non-invasive and cost-saving procedures, and it is emerging the concept to use it for the detection of inflammatory biomarkers. To this purpose, the present review aims to discuss the advantages and challenges of using standard and cutting-edge techniques to discover salivary biomarkers which may be used in diagnosis/therapy of several chronic diseases with inflammatory consequences with the pursuit to possibly replace conventional paths with detectable soluble mediators in saliva. Specifically, the review describes the procedures used for saliva collection, the standard approaches for the measurement of salivary biomarkers and the novel methodological strategies such as biosensors to improve the quality of care for chronically affected patients.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Biomarkers
;
Cytokines
;
Inflammation/diagnosis*
;
Oxidative Stress
8.Decreasing complexity of glucose time series derived from continuous glucose monitoring is correlated with deteriorating glucose regulation.
Cheng LI ; Xiaojing MA ; Jingyi LU ; Rui TAO ; Xia YU ; Yifei MO ; Wei LU ; Yuqian BAO ; Jian ZHOU ; Weiping JIA
Frontiers of Medicine 2023;17(1):68-74
Most information used to evaluate diabetic statuses is collected at a special time-point, such as taking fasting plasma glucose test and providing a limited view of individual's health and disease risk. As a new parameter for continuously evaluating personal clinical statuses, the newly developed technique "continuous glucose monitoring" (CGM) can characterize glucose dynamics. By calculating the complexity of glucose time series index (CGI) with refined composite multi-scale entropy analysis of the CGM data, the study showed for the first time that the complexity of glucose time series in subjects decreased gradually from normal glucose tolerance to impaired glucose regulation and then to type 2 diabetes (P for trend < 0.01). Furthermore, CGI was significantly associated with various parameters such as insulin sensitivity/secretion (all P < 0.01), and multiple linear stepwise regression showed that the disposition index, which reflects β-cell function after adjusting for insulin sensitivity, was the only independent factor correlated with CGI (P < 0.01). Our findings indicate that the CGI derived from the CGM data may serve as a novel marker to evaluate glucose homeostasis.
Humans
;
Glucose
;
Blood Glucose
;
Insulin Resistance/physiology*
;
Diabetes Mellitus, Type 2/diagnosis*
;
Blood Glucose Self-Monitoring
;
Time Factors
;
Insulin
9.Associations between glycated hemoglobin and glucose indicators in adults in areas at different altitude in China.
Xiao ZHANG ; Mei ZHANG ; Chun LI ; Zheng Jing HUANG ; Meng Ting YU ; Li Min WANG
Chinese Journal of Epidemiology 2023;44(3):401-407
Objective: To explore the associations of glycated hemoglobin (HbA1c) with FPG and oral glucose tolerance test 2-hour (OGTT-2 h) in areas at different altitude in China. Methods: Subjects who participated in 2018-2019 China Chronic Disease and Risk Factor Surveillance and had no prior type 2 diabetes diagnosis were included. Subsequently, they were categorized into three groups based on altitude of living area (<2 000, 2 000- and ≥3 000 m). With adjustment for intracluster correlation, multivariable linear regression analysis was performed to evaluate the associations of HbA1c with FPG and OGTT-2 h in the context of HbA1c was normal (<5.7%) or abnormal (≥5.7%). Furthermore, the shape of relationships between HbA1c and glucose indicators was examined using restricted cubic spline. Finally, receiver operating characteristic curve was used to evaluate the diagnostic performance of HbA1c for diabetes. Results: A total of 157 277 subjects were included in the analysis. While FPG and OGTT-2 h levels gradually decreased with increase of altitude, HbA1c level was similar among the three groups. When HbA1c was <5.7%, its association with FPG and OGTT-2 h was weak and no obvious difference was observed among the three groups. When HbA1c was ≥5.7%, the FPG and OGTT-2 h increased by 15.45% (95%CI:14.71%- 16.18%) and 24.54% (95%CI:23.18%-25.91%) respectively per one standard deviation increase in HbA1c in group in area at altitude <2 000 m. However, the FPG and OGTT-2 h increased by 13.08% (95%CI:10.46%-15.76%) and 21.72% (95%CI:16.39%-27.31%), respectively, in group in area at altitude 2 000- m, and increased by 11.41% (95%CI:9.32%-13.53%) and 20.03% (95%CI:15.38%- 24.86%), respectively, in group of altitude ≥3 000 m. The restricted cubic spline indicated that the curve showing the association of HbA1c with FPG and OGTT-2 h was flat when HbA1c was <5.7%, but showed a positive linear relationship when HbA1c was ≥5.7%. The area under curve for detecting diabetes was 0.808 (95%CI:0.803-0.812) in group of altitude <2 000 m and 0.728 (95%CI:0.660-0.796, P=0.022) in group of altitude ≥3 000 m. The relevant optimal cutoff value of HbA1c was 5.7%, with a sensitivity of 65.4% and a specificity of 83.0%, and 6.0%, with a sensitivity of 48.3% and a specificity of 93.7%, respectively. Conclusions: When HbA1c was ≥5.7%, the association between HbA1c and glucose indicators became weaker as the increase of altitude. In the area at altitude ≥3 000 m, it may not be appropriate to use HbA1c in the diagnosis of diabetes.
Adult
;
Humans
;
Glycated Hemoglobin
;
Diabetes Mellitus, Type 2/diagnosis*
;
Blood Glucose/analysis*
;
Glucose
;
Altitude
;
Fasting
;
China/epidemiology*
;
Diabetes Mellitus/epidemiology*
10.Prevalence of maturity-onset diabetes of the young in phenotypic type 2 diabetes in young adults: a nationwide, multi-center, cross-sectional survey in China.
Yan CHEN ; Jing ZHAO ; Xia LI ; Zhiguo XIE ; Gan HUANG ; Xiang YAN ; Houde ZHOU ; Li ZHENG ; Tao XU ; Kaixin ZHOU ; Zhiguang ZHOU
Chinese Medical Journal 2023;136(1):56-64
BACKGROUND:
Maturity-onset diabetes of the young (MODY) is the most common monogenic diabetes. The aim of this study was to assess the prevalence of MODY in phenotypic type 2 diabetes (T2DM) among Chinese young adults.
METHODS:
From April 2015 to October 2017, this cross-sectional study involved 2429 consecutive patients from 46 hospitals in China, newly diagnosed between 15 years and 45 years, with T2DM phenotype and negative for standardized glutamic acid decarboxylase antibody at the core laboratory. Sequencing using a custom monogenic diabetes gene panel was performed, and variants of 14 MODY genes were interpreted as per current guidelines.
RESULTS:
The survey determined 18 patients having genetic variants causing MODY (6 HNF1A , 5 GCK , 3 HNF4A , 2 INS , 1 PDX1 , and 1 PAX4 ). The prevalence of MODY was 0.74% (95% confidence interval [CI]: 0.40-1.08%). The clinical characteristics of MODY patients were not specific, 72.2% (13/18) of them were diagnosed after 35 years, 47.1% (8/17) had metabolic syndrome, and only 38.9% (7/18) had a family history of diabetes. No significant difference in manifestations except for hemoglobin A1c levels was found between MODY and non-MODY patients.
CONCLUSION
The prevalence of MODY in young adults with phenotypic T2DM was 0.74%, among which HNF1A -, GCK -, and HNF4A -MODY were the most common subtypes. Clinical features played a limited role in the recognition of MODY.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Cross-Sectional Studies
;
Mutation
;
Prevalence
;
Phenotype


Result Analysis
Print
Save
E-mail