OBJECTIVE: To analyze the clinical characteristics and CSNK2B gene variant of 2 children with Poirier-Bienvenu neurodevelopmental syndrome, and to identify the possible pathogenic causes and provide evidence for clinical diagnosis. METHODS: Two children with Poirier-Bienvenu neurodevelopmental syndrome were selected from West China Second University Hospital, Sichuan University. The clinical manifestations, laboratory examination and CSNK2B gene variant were analyzed. RESULTS: The main manifestations of 2 children were epilepsy, motor or intellectual retardation. Whole exon sequencing showed that CSNK2B gene c. 291+4A>T heterozygous splicing variant was found in case one, and CSNK2B copy number variation(CNV) was lost in case two. Case one received no special treatment, followed up for 8+ months, seizures and motor development were improved; case two had recurrent seizures for 9+ years, and received levetiracetam and clonazepam antiepileptic treatment. No seizures have occurred for 2 years now, and a large number of epileptic discharges can still be seen in video electroencephalogram (VEEG) with slightly backward intelligence and language development. CONCLUSION Our study further proves that the pathogenic variant of CSNK2B is related to epilepsy with developmental disorder, and enrich is the CSNK2B gene variant spectrum. The pathogenesis of CSNK2B has great clinical heterogeneity, with great difference in severity of nervous system injury and different prognosis, and agenesis of corpus callosum may be one of its clinical phenotypes.
Child ; DNA Copy Number Variations ; Developmental Disabilities/genetics* ; Epilepsy/genetics* ; Humans ; Intellectual Disability/genetics* ; Seizures/genetics*

Child ; Developmental Disabilities/genetics* ; Frameshift Mutation ; Humans ; Seizures/genetics* ; Seizures, Febrile/genetics* ; Semaphorins/genetics*

Developmental Disabilities ; diagnosis ; etiology ; genetics ; Humans ; Nervous System Malformations ; diagnosis ; etiology ; genetics

OBJECTIVE: To explore the genetic basis for a child with succinate semialdehyde dehydrogenase deficiency. METHODS: Peripheral blood samples of the proband and his parents were collected and subjected to Sanger sequencing. High-throughput sequencing was used to verify the gene variants. Bioinformatic software was used to analyze the pathogenicity of the variant sites. RESULTS: Sanger sequencing showed that the proband carried a homozygous c.1529C>T (p.S510F) variant of the ALDH5A1 gene, for which his mother was a carrier. The same variant was not detected in his father. However, high-throughput sequencing revealed that the child and his father both had a deletion of ALDH5A1 gene fragment (chr6: 24 403 265-24 566 986). CONCLUSION The c.1529C>T variant of the ALDH5A1 gene and deletion of ALDH5A1 gene fragment probably underlay the disease in the child. High-throughput sequencing can detect site variation as well as deletion of gene fragment, which has enabled genetic diagnosis and counseling for the family.
Amino Acid Metabolism, Inborn Errors/genetics* ; Child ; Developmental Disabilities ; Humans ; Infant ; Mutation ; Succinate-Semialdehyde Dehydrogenase/genetics*

OBJECTIVE: To analyze the clinical features and genetic variants in two unrelated patients with psychomotor retardation and facial abnormalities, and to explore their genotype-phenotype correlation. METHODS: Clinical data and family history of the two pedigrees were collected. Whole exome sequencing (WES) and Sanger sequencing were carried out to detect the potential variants. RESULTS: Both patients had presented with mental and language retardation, along with growth delay and facial anomalies. They were both found to harbor de novo loss-of-function variants in exon 12 of the ASXL3 gene, namely c.3096dup (p.Pro1033Thrfs*2) and c.3253G>T (p.Gly1085*). Neither variant was reported previously. Combined with their clinical features and genetic finding, both patients were diagnosed with Bainbridge-Ropes syndrome due to pathogenic variants of the ASXL3 gene. CONCLUSION Diagnosis of Bainbridge Ropes syndrome in the two pedigrees has enriched the genotypic and phenotypic spectrum of this disorder and enabled genetic counseling for them.
Child ; China ; Developmental Disabilities/genetics* ; Humans ; Language ; Mutation ; Pedigree ; Phenotype ; Transcription Factors/genetics*

OBJECTIVE: To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism. METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis. RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin. CONCLUSION The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Autistic Disorder/genetics* ; Child ; Developmental Disabilities ; Female ; Humans ; Mutation ; Retrospective Studies ; Syndrome ; Transcription Factors/genetics*

OBJECTIVE: To assess the value of copy number variations (CNVs) and chromosomal karyotyping analysis for patients with intellectual disability/developmental delay (ID/DD). METHODS: Chromosomal karyotype analysis was applied to 530 children diagnosed with ID/DD. Single nucleotide polymorphism array (SNP-array) was further applied for 120 children with unknown etiology. RESULTS: Among the 530 children with ID/DD, 104 (19.62%) were detected with chromosomal abnormalities. For the 120 children analyzed by SNP-array, 44 (36.67%) were detected with CNVs, among which 20 were predicted as pathogenic, 6 as likely pathogenic, 10 as variants of unknown significance, 7 as likely benign,and 1 as loss of heterozygosity. CONCLUSION SNP-array can facilitate delineation of the etiology of patients with ID/DD, which may provide a basis for their prognosis, consultation and clinical intervention.
Child ; Chromosome Aberrations ; DNA Copy Number Variations ; Developmental Disabilities/genetics* ; Humans ; Intellectual Disability/genetics* ; Karyotyping

OBJECTIVE: To explore the clinical characteristics and genetic etiology of a child with Schaaf-Yang syndrome (SYS). METHODS: Peripheral blood samples of the child and his parents were collected and subjected to whole exome sequencing. Sanger sequencing was used for family constellation verification, and bioinformatic analysis was performed for the candidate variant. RESULTS: The child, a 1-year-and-9-month-old boy, had clinical manifestations of retarded growth, small penis, and unusual facies. Genetic testing revealed that the child has harbored a novel heterozygous variant of c.3078dupG (p.Leu1027Valfs*28) of the MAGEL2 gene. Sanger sequencing showed that neither parent of the child carried the same variant. The c.3078dupG(p.Leu1027Valfs*28) variant of the MAGEL2 gene has not been included in the databases of ESP, 1000 Genomes and ExAC. According to the Standards and Guidelines for the Interpretation of Sequence Variants of the American College of Medical Genetics and Genomics (ACMG), the variant was judged to be pathogenic. CONCLUSION The c.3078dupG (p.Leu1027Valfs*28) variant of the MAGEL2 gene probably underlay the SYS in this child, which has further expanded the spectrum of the MAGEL2 gene variants.
Child ; Humans ; Infant ; Male ; Exome Sequencing ; Genetic Testing ; Heterozygote ; Mutation ; Proteins/genetics* ; Developmental Disabilities/genetics*

OBJECTIVE: To explore the clinical and genetic characteristics of two children with developmental delay. METHODS: Two children who had presented at the Children's Hospital Affiliated to Shandong University on August 18, 2021 were enrolled as the study subjects. Clinical and laboratory examination, chromosomal karyotyping and high-throughput sequencing were carried out for both children. RESULTS: Both children had a 46,XX karyotype. High-throughput sequencing showed that they have respectively carried a c.489delG (p.Q165Rfs*14) and a c.1157_1158delAT (p.Y386Cfs*22) frameshifting variant of the CTCF gene, both had a de novo origin and were unreported previously. CONCLUSION The CTCF gene variants probably underlay the development delay in the two children. Above discovery has enriched the mutational spectrum of the CTCF gene and has important implications for revealing the genotype-phenotype correlation for similar patients.
Child ; Humans ; Developmental Disabilities/genetics* ; High-Throughput Nucleotide Sequencing ; Intellectual Disability/genetics* ; Karyotyping ; Mutation

OBJECTIVE: To analyze the clinical phenotype and pathogenic variant in a child diagnosed with mental retardation and microcephaly with pontine and cerebellar hypoplasia (MICPCH). METHODS: Clinical phenotype of the child was reviewed. Whole exome sequencing was carried out for the child. Candidate variant was verified by Sanger sequencing of the family member. RESULTS: The proband manifested dyskinesia, development delay, cerebellar hypoplasia and bilateral hearing impairment. WES results revealed that the proband has carried a pathogenic c.1641_1644delACAA (p.Thr548Trpfs*69) variant of the CASK gene, which was verified by Sanger sequencing to be a de novo variant. CONCLUSION The c.1641_1644delACAA (p.Thr548Trpfs*69) variant of the CASK gene probably underlay the MICPCH in the proband. Above finding has provided a basis for genetic counseling. WES should be considered for the diagnosis of neurological dysplasia.
Cerebellum/abnormalities* ; Child ; Developmental Disabilities ; Family ; Humans ; Mental Retardation, X-Linked ; Microcephaly/genetics* ; Nervous System Malformations