1.Concepts and practice of pylorus-preserving gastrectomy in gastric cancer.
Chinese Journal of Surgery 2009;47(17):1285-1287
Gastrectomy
;
methods
;
Humans
;
Pylorus
;
surgery
;
Stomach Neoplasms
;
surgery
2.Correlation between percentages of PMN, MNC, FBC and wound age after skeletal muscle injury in rats.
Tian-Shui YU ; Da-Wei GUAN ; Rui ZHAO ; Hai-Dong ZHANG ; Ru-Feng BAI
Journal of Forensic Medicine 2014;30(3):166-168
OBJECTIVE:
To study the percentages of polymorphonuclear leukocytes (PMN), mononuclear cells (MNC) and fibroblastic cells (FBC) in different post-traumatic intervals after skeletal muscle mechanical injury in rats.
METHODS:
The rat model of skeletal muscle mechanical injury was established. The rats were divided into injured groups (6 h, 12 h, 1 d, 3 d, 7 d, 10 d and 14 d after injury) and control group. The percentages of PMN, MNC and FBC in different post-traumatic intervals after skeletal muscle mechanical injury were assessed with HE staining and image analysis.
RESULTS:
At post-injury 6-12h, the percentages of PMN and MNC infiltration appeared in injured sites and that of PMN reached peak. At 1 d, the percentage of MNC infiltration appeared and reached peak, while that of PMN decreased. At 3-7 d, the percentage of FBC gradually increased, while that of PMN and MNC decreased. At 10-14d, the percentage of FBC reached peak.
CONCLUSION
The percentages of PMN, MNC and FBC in injured zones showed time-dependent changes, which might be used as reference index for determination of age of skeletal muscle injury.
Animals
;
Fibroblasts
;
Muscle, Skeletal/injuries*
;
Neutrophils
;
Rats
;
Time Factors
3.Efficacy observation after pylorus-preserving gastrectomy for early gastric cancer.
Xiang HU ; Liang CAO ; Yi YU ; Da-yu TIAN
Chinese Journal of Gastrointestinal Surgery 2010;13(12):907-909
OBJECTIVETo evaluate the outcomes after pylorus-preserving gastrectomy (PPG) for early gastric cancer(EGC).
METHODSClinicopathologic data of 52 patients with EGC undergoing PPG between August 1995 and December 2005 were analyzed retrospectively. A total of 159 patients of EGC who underwent distal gastrectomy with lymph node dissection(control group) were compared with those who received PPG.
RESULTSThe lymph node metastasis rate of EGC was 9.6% in PPG group, including 9.6% in No.3, 3.9% in No.4, 3.9% in No.6, and 3.9% in No.7. In the control group, the lymph node metastasis rate was 17.0%, including N1(14.5%) and N2(2.5%). There were no significant differences between the PPG group and the control group (P>0.05). In the PPG group, D1 dissection was 25%, D1+α was 25%, D1+β was 34.6%, and D2 was 15.3%. In control group, 121 patients(76.1%) had less than D2 dissection, while there were 33(20.7%) D2, and 5(3.1%) D3, and the difference was not statistically significant(P>0.05). There were no significant differences between the two groups in overall 5-year survival rate(92.3% vs. 93.1%, P=0.881). The 5-year survival rate in the PPG group was 100% for D1, 92.3% for D1+α, 88.9% for D1+β, and 85.7% for D2, while the 5-year survival rate in the control group was 92.3% for D1, 93.3% for D1+α, 91.7% for D1+β, and 93.9% for D2. The difference was not statistically significant(P>0.05). The recurrence rate was comparable (5.7% vs. 5.6%, P>0.05).
CONCLUSIONPylorus-preserving gastrectomy may provide long-term survival benefits for patients with early gastric cancer.
Adult ; Aged ; Female ; Follow-Up Studies ; Gastrectomy ; methods ; Humans ; Male ; Middle Aged ; Pylorus ; surgery ; Retrospective Studies ; Stomach Neoplasms ; surgery ; Treatment Outcome ; Vagus Nerve ; surgery
4.Role of p38MAPK signaling pathways in the apoptosis of C2C12 myoblast cells subjected to cyclical stretch
Zhen TIAN ; Zhuli YANG ; Wenmin JIA ; Xiao YUAN ; Jing QIU ; Yu DA ; Yanxiao DU ; Jiangbo YU ; Yue ZHANG ; Wen LIU
Chinese Journal of Tissue Engineering Research 2011;15(15):2751-2754
BACKGROUND: Because of complicated physiological environment and difficulty to control experimental conditions, it is difficult to get satisfactory results from in vivo studies of cell mechanics.OBJECTIVE: To study the action and mechanism of p38MAPK signaling pathways on myoblast apoptosis based on successful construction of in vitro mechanical stimulation models.METHODS: The C2C12 cells cultured in vitro were divided into control group and SB203580 treatment group. Cyclic tensile stress was applied on the C2C12 myoblast cells for 0, 6, 12 and 24 hours in each group. The Flexcell Strain Unit-5000T was used to expose C2C12 myoblast cell to an equiaxial cyclic of 15% magnitude and a frequency of 10 cycles/min, each cycle including the 3 s stretch and 3 s relaxation. Hoechst 33258 fluorescent staining and optical microscope were used to detect cell apoptosis. RT-PCR, flow cytometric analysis were used to observe the apoptosis of C2C12 myoblast cells and Western blotting were used to detect the activity of p38MAPK and p-p38MAPK. RESULTS AND CONCLUSION: The optical microscope tested the change in the morphology. Hoechst 33258 staining showed that after treatment with cyclic stress, the cell took the typical appearance of apoptosis with chromatin condensation and apoptotic bodies. RT-PCR and flow cytometry showed that with the extension of time the rate of the apoptosis of C2C12 myoblast cell increased. And cells imposed SB203580 before imposing cyclical tensile stress, the results showed that the apoptosis was markedly affected, and the p-p38MAPK expression declined apparently. These findings demonstrate that p38MAPK signaling pathways in stress mediated into C2C12 myoblast cell apoptosis plays an important role.
5.Clinical results following microsurgical discectomy: comparison of microscope and loupes
Wei TIAN ; Xiao HAN ; Da HE ; Bo LIU ; Zhiyu LI ; Sai MA ; Jie YU ; Kai YAN ; Peihao JIN
Chinese Journal of Orthopaedics 2011;31(10):1132-1137
ObjectiveTo Compare the clinical results between microscope and loupes which used in microsurgical discectomy.MethodsA prospective randomized controlled trial of 93 patients who had undergone microsurgical discectomy from January 2007 to December 2010 was performed.Clinical results were assessed by comparing the following parameters between patients who had undergone the surgery by microscope and loupes:length of stay,hospitalization cost,operative time,estimated blood loss,Japanese Orthopaedic Association (JOA) score and JOA recovery rate,Odom's standard.ResultsForty-nine patients underwent surgery by microscope,and forty-four patients underwent surgery by loupes.Eighty patients received outpatient or telephone follow-up.The follow-up period was 6.17 to 52.90 months with an average of (29.64±13.05) months,and the follow-up rate was 86.02%.According preoperative data,the two groups didn't differ with respect to age,gender,level of radiculopathy,or preoperative JOA score and JOA recovery rate.No statistically significant differences were identified in postoperative JOA score and JOA recovery rate,length of stay,hospitalization cost,length of follow-up,or relapse rate.Statistically significant differences were identified in operative time,estimated blood loss,and follow-up JOA score and JOA recovery rate.Conclusion Microscope can provide relatively more clear and comfortable vision for the surgery.It can short the operative time,decrease blood loss,reduce the potential risk of nerve injury,and retain more normal tissue,which can ensure better clinical results.
6.Investigate on rational lymph-node dissection for gastric cardia cancer.
Xiang HU ; Da-yu TIAN ; Quan BAO
Chinese Journal of Gastrointestinal Surgery 2007;10(2):127-129
OBJECTIVETo investigate the rule of lymph-node metastasis in gastric cardia cancer and the rational extent of lymph node dissection.
METHODSClinicopathological data of 77 patients with gastric cardia cancer were reviewed and the relationship between extent of lymph-node dissection and prognosis was analyzed retrospectively.
RESULTS(1) The lymph node metastasis rates were 64.9% for N(1), 14.3% for N(2) and 10.4% for N(3). (2) No lymph node metastasis was detected in T(1) stage tumor and maximum diameter of less than 2.0 cm. The lymph node metastasis rates were 20% for T(2), 68.2% for T(3) and 82.8% for T(4) respectively. (3) Lymph node No.1, 3, 2 were often involved in the metastasis of lymph node group 1, and No.7, 8, 10, 9 in Group 2. In lymph node group 3, lymph node metastasis rates were 6.5% for No.5, 1.3% for No.6, 1.3% for No.16 and 2.6% for No.107-110. (4) The five-year survival rates were 36.5% for D(3), 31.3% for D(2), and 22.7% for D(1) lymphadenectomy respectively. The survival rates of patients undergone D(2) and D(3) lymphadenectomy were significantly higher than that undergone D(1) dissection (P<0.05).
CONCLUSIOND(2) or more than D(2) lymphadenectomy associated with enlargement of esophageal hiatus via laparotomy, lower partial esophagectomy and total gastrectomy is able to achieve surgical resectability and improve the survival rate of gastric cardia cancer patients.
Cardia ; Female ; Humans ; Lymph Node Excision ; Lymph Nodes ; pathology ; surgery ; Lymphatic Metastasis ; Male ; Middle Aged ; Neoplasm Staging ; Retrospective Studies ; Stomach Neoplasms ; pathology ; surgery
7.Time-dependent appearances of myofibroblasts during the repair of contused skeletal muscle in rat and its application for wound age determination.
Tian-Shui YU ; Da-Wei GUAN ; Lin CHANG ; Xu WANG ; Rui ZHAO ; Hai-Dong ZHANG ; Ru-Feng BAI
Journal of Forensic Medicine 2015;31(1):1-6
OBJECTIVE:
To research the relation between the time-dependent appearances of myotibroblasts during the repair of contused skeletal muscle in rat and wound age determination.
METHODS:
A total of 35 SD male rats were divided into the control and six injured groups according to wound age as follows: 12 h, 1 d, 5 d, 7 d, 10 d and 14 d after injury. The appearances of myofibroblasts were detected by HE staining, immunohistochemistry and confocal laser scanning microscopy. Masson's trichrome staining was utilized to examine collagen accumulation in the contused areas.
RESULTS:
Immunohistochemical staining showed that α-SMA+ myofibroblasts were initially observed at 5 d post-injury. The average ratio of myofibroblasts was highest at 14 d post-injury, with all samples, ratios more than 50%. In the other five groups, the average of α-SMA positive ratios were less than 50%. The collagen stained areas in the contused zones, concomitant with myofibroblast appearance, were increasingly augmented along with advances of posttraumatic interval.
CONCLUSION
The immunohistochemical detection of myofibroblasts can be applied to wound age determination. The myofibroblasts might be involved in collagen deposition during the repair of contused skeletal muscle in rat.
Animals
;
Collagen/metabolism*
;
Contusions/metabolism*
;
Immunohistochemistry
;
Male
;
Microscopy, Confocal
;
Muscle, Skeletal/metabolism*
;
Myofibroblasts/metabolism*
;
Rats
;
Time Factors
;
Wound Healing
8.Classification and morphology of jugular bulb and its clinical significance
Guang-Yong TIAN ; Da-Chuan XU ; De-Liang HUANG ; Lu-Jun HAN ; Zhi-Qiang PENG ; Ze-Yu LI ; Xiao-Tian SHI
Chinese Journal of Neuromedicine 2008;7(5):483-486,494
Objective To observe the anatomic and imaging morphology ofjugnlar bulb and its relationship with the surrounding structures, and to investigate the classification ofjugnlar bulb and its clinical significance. Methods We dissected 30 human temporal bones and studied multi-slice spiral CT imaging data of temporal bone of 120 cases and blood vessel cast mould specimen of the jugular bulb of 6 cases, to observe the morphology of jugnlar bulb and its spatial relationship with the surrounding structures. We made an imagined sagittal plane on the medial well of the tympanic cavity, with a horizontal tangent line of the proximal wall of the tympanic cavity and a vertical tangent line of the posterior wall of the tympanic cavity as coordinate axes (X axis and Y axis), respectively, so the 4 quadrants ( Ⅰ , Ⅱ, Ⅳ, Ⅳ) were formed. The jugular bulb was classified intro 4 types according to the quadrant where its top was projected and subtyped according to its position on the inner or outer side of the plane. The operation via mastoid approach was simulated on specimen to observe the effect of jugnlar bulb on the operation route. Results Some jugular bulbs were flat type and others were prominent types. The classification in the group of CT image: type Ⅰ , 11 case (9%);type Ⅱ, 63 cases (53%);type Ⅲ, 25 cases (21%);type Ⅳ, 21cases (17%). The classification in the group of specimen: type Ⅰ, 1 case (3%);type Ⅱ, 11 cases (37%);type Ⅲ, 8 cases (27%);type Ⅳ, 10 cases (33%). Each type of the jugular bulb had different effects on the operative approach. Conclusions The classification method with the 4 quadrants is a simple and three-dimensional way to describe the position of the jugular bulb for imaging diagnosis or operative scheme design.
9.Molecular genetic analysis of FUT1 and FUT2 gene in para-Bombay Chinese: a novel FUT1 allele is identified.
Yu qing SU ; Tian-li WEI ; Qiong YU ; Yan-lian LIANG ; Da-cheng LI
Chinese Journal of Medical Genetics 2007;24(5):520-523
OBJECTIVEMolecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.
METHODSSeven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.
RESULTSThe FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.
CONCLUSIONA novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.
Alleles ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; Ethnic Groups ; genetics ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Pedigree ; Phenotype ; Polymerase Chain Reaction ; Sequence Analysis, DNA ; Serologic Tests
10.Fluorine-18 fluorodeoxyglucose uptake in patients with benign pulmonary nodules.
Chang-hai YU ; Tao WANG ; Yu-e SUN ; Shu-lin YAO ; Jia-he TIAN ; Da-yi YIN
Chinese Journal of Surgery 2006;44(2):90-92
OBJECTIVETo assess the features of fluorine-18 fluorodeoxyglucose (FDG) uptake in patients with benign pulmonary nodules.
METHODSFrom October 1998 to July 2004, 47 patients with benign pulmonary nodules were imaged with FDG-positron emission tomography (PET). Diagnoses were confirmed by surgery. FDG-PET data was analyzed by visual method and semi-quantitive method. When pulmonary nodules with abnormal FDG intake appeared in PET scans confirmed by visual method, their maximum and mean standard uptake value (SUVmax and SUVmean) and SUV of normal lung (SUVlung) were measured using semiquantitative method.
RESULTSTwenty-one cases showed nothing abnormal in PET scans, including 17 calcification and fibrosis, 2 hamartomas and 2 sclerosing hemangiomas. 26 pulmonary nodules were detected by FDG-PET (17 active tuberculous, 6 inflammatory pseudotumors, 3 cryptococcosis). FDG uptake of these 26 nodules was higher than that of normal lung (SUVmax, SUVmean and SUVlung were 3.04 +/- 1.65, 2.48 +/- 1.35 and 0.40 +/- 0.07, respectively, P < 0.001). Correlations were not found between FDG uptake and nodule size or SUV of normal lung or age or blood glucose level in these 26 patients (P > 0.05). SUV in 9 cases (9/26, 35%) were beyond 2.5.
CONCLUSIONSSome benign pulmonary nodules were FDG avid.
Adult ; Aged ; Diagnosis, Differential ; Female ; Fluorodeoxyglucose F18 ; pharmacokinetics ; Humans ; Lung Neoplasms ; diagnostic imaging ; Male ; Middle Aged ; Radionuclide Imaging ; Radiopharmaceuticals ; pharmacokinetics ; Retrospective Studies ; Sarcoidosis, Pulmonary ; diagnostic imaging ; Solitary Pulmonary Nodule ; diagnostic imaging ; Tuberculosis, Pulmonary ; diagnostic imaging