BACKGROUND: More recently,repair of skull defect with computer-designed prosthesis contributes to the revolutionary development of skull reconstruction technique. OBJECTIVE: To individually molded titanium mesh by computer-aided design (CAD) technique,and to observe the clinical application value of the titanium mesh in the repair of large-area skull defects in the fronto- temporo-parietal lobes. DESIGN,TIME AND SETTING: A retrospective case analysis was performed at the Department of Neurosurgery,Liuzhou People's Hospital between January 2006 and August 2007.PARTICIPANTS: A total of 16 patients comprising 12 males and 4 females,aged 16-52 years,suffered from skull defects in the fronto-temporo-parietai lobes following standard large trauma craniotomy and were recruited into this stud Two of these patients were complicated by hydrocephalus and received ventriculoperitoneal shunt. Skull defect area ranged between 9. 2 cm ×11.2 cm and 12.2 cm×14.6 cm. Skull defect neoplasty was performed in all patients 3-8months following standard large trauma craniotomy. METHODS: Titanium mesh patches were individually modeled by CAD,computer-aided manufacturing (CAM) and rapid shaping techniques and implanted into skull defect region. In addition,defect edge was fastened with titanium nails. MAIN OUTCOME MEASURES: Moulding effects and complications following skull defect neoplasty. RESULTS: A small amount of subcutaneous effusion was found in one patient and disappeared after liquid extraction and pressure dressing. Titanium mesh was firmly fixed with no loosening. Patients exhibited left-right symmetry,appropriate lateral curvature,no irregular umbilication or chewing dysfunction. All patients were followed for 3-18 months postoperatively and were satisfied with good resuRs,Le.,no complications,infection,material exposure,loosening,or collapse. CONCLUSION: CAD technique used for repair of skull defects is convenient,effective,and safe. This method can. reduce postoperative complications and improve repair effects.

Aim The purpose of this study was to compare the differential expression of 15-lipoxygenase isoenzymes in the pulmonary arteries between normoxia and hypoxia and to explore their roles in the formation of hypoxic pulmomary vasoconstriction. Method Eighteen SD rats were randomly divided into two groups(n=9):the normoxic control group breathing fresh gas and the hypoxic group breeding in animal hypoxic incubator.Immunohistochemical method,in situ hybridization and Western blot were employed to determine certain 15-lipoxygenase isoenzymes which involved in the process of hypoxic pulmonary vasoconstriction.Results ①In normoxic control group,the expression of 15-LO-1 protein was detected in the pulmonary arteries;but the expression of 15-LO-2 protein wasn’t detected.②The expression of 15-LO-1 protein in hypoxic group was much stronger than that in normoxic group (P

The study is to develop a method to determine 3 batches leaves of Nauclea officinalis and stems of N. officinalis by HPLC. The differences between strictosamide contents and fingerprints was compared, then chromatographic peak of fingerprints was validated with the assistance of LC-MS. The strictosamide contents in stems of N. officinalis were higher than leaves of N. officinalis. The main chemical composition in leaves of N. officinalis and stems of N. officinalis were alkaloid which revealed by LC-MS. There are 7 chemical compositions were same between them, but the chemical composition in leaves of N. officinalis is more than stems of N. officinalis. This provides a scientific basis for the development of the potential medicinal value of leaves of N. officinalis and the sustainable utilization of N. officinalis.
Chromatography, High Pressure Liquid ; Drugs, Chinese Herbal ; chemistry ; isolation & purification ; Molecular Structure ; Plant Leaves ; chemistry ; Plant Stems ; chemistry ; Rubiaceae ; chemistry ; Spectrometry, Mass, Electrospray Ionization

AIM To investigate the improving effect of Suoquan Capsules (Linderae Radix,Alpiniae oxyphyllae Fructus and Dioscoreae Rhizoma) on mice with diabetic cystopathy and its mechanism of action.METHODS Sixty mice were randomly assigned into normal group (n =8) and model group (n =52);the diabetic models of the latter were induced by high-fat feeding combined with streptozotocin (STZ) injection,then modeled mice (n =32) were randomly divided into model,Mecobalamin Tablets,low-and high-dose Suoquan Capsules groups.The influences of Suoquan Capsules on fasting blood glucose (FBG),glycated serum protein (GSP) level and general conditions were observed.The bladder leak point pressure (BLPP) was determined.Histopathological staining was performed on urinary bladder.And the expressions of substance P and NK1 receptor were detected by double immunofluorescent staining.RESULTS There were no significant differences in FBG,GSP,body weight,food intake and water consumption among various groups.The high-dose Suoquan Capsules significantly decreased urine volume of mice.Compared with the model group,the treatment with Suoquan Capsules markedly increased BLPP,the expressions of substance P and NK1 receptor were significantly increased,and the histopathology of bladder in mice was obviously improved.CONCLUSION Suoquan Capsules improves the diabetic cystopathy in mice,and its mechanism maybe related to the up-regulation of substance P and NK1 receptor expressions in bladder tissue.

Without serum to provide adherent factors, CHO-dhfr- cells grow in suspension when cultured in serum-free medium. Although this offers advantages in some applications, in most production systems adherent cell growth is preferable. Gene transfection, clonal selection and amplification can be easier for adherent cells; the density of immobilized cells is often higher than those in suspension culture, which results in a higher protein productivity; washout of cells by perfused medium during continuous fermentation can be avoided; for high-throughput microplate assays, adherent cells are preferred to facilitate medium changes and cell washing. It has been proved that purified vitronectin alone was able to mediate attachment and spreading of CHO cells in serum-free medium. So we constructed a tricistronic expression vector expressing Igf-1, Vitronectin and Bel-2 at the same time. The vector was transfected into CHO-dhfr- cells and one clone, namely CHO-IVB2, expressing high level of the three proteins was screened out by Western blot. The cell line showed similar apoptosis-resistant and serum-independent properties to CHO-IB, an engineered cell line constructed before. When cultured in IMEM protein-free medium without any components supplemented, CHO-IVB can grow adherently. The viable cell numbers and growth rate of CHO-IVB were much higher than CHO-IB, making CHO-IVB an apoptosis-resistant host for production of recombinant proteins which can grow adherently in protein-free medium.
Animals ; Apoptosis ; CHO Cells ; physiology ; Cell Adhesion ; Cell Line ; Cell Proliferation ; Cricetinae ; Cricetulus ; Culture Media, Serum-Free ; Flow Cytometry ; Mice ; Mice, Inbred BALB C ; Recombinant Proteins ; biosynthesis ; Vitronectin ; genetics

OBJECTIVEMolecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.

METHODSSeven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.

RESULTSThe FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.

CONCLUSIONA novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.

Alleles ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; Ethnic Groups ; genetics ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Pedigree ; Phenotype ; Polymerase Chain Reaction ; Sequence Analysis, DNA ; Serologic Tests

Mammalian cells are prone to apoptosis when cultured in large scale for production of biopharmaceuticals. And this will reduce production duration and result in high cost of production. Apoptosis is triggered by various factors, and delicately regulated by a set of genes. Bcl-2, a component integrated in mitochondria membrane, is an important member of these genes. By maintaining the integrity of mitochondria membrane, Bcl-2 keeps cytochrome C from releasing into cytoplasm, and thus blocks the activation of caspases, and subsequent onset of apoptosis. Over-expression of Bcl-2 has proven to be useful in blocking apoptosis in various cell lines, including CHO, hybridoma, myeloma, lymphoma and insect cells. Ammonia, a metabolite of cultured cells, however, showed apparent pro-apoptosis activity. In living cells, ammonia can be utilized by glutamine synthetase (GS) to synthesize glutamine, and thus lower the concentration of ammonia in medium, and its negative effects. Glutamine is essential to living cells. If not added into medium, glutamine can only be synthesized by GS, which makes GS a qualified selection marker. This marker can be used for gene amplification by adding into medium increased concentration of MSX, an inhibitor of GS. In this study, we over-expressed Bcl-2 using GS amplification in a recombinant CHO cell line stably expressing human interferon-beta. The modified cell line, with higher expression of Bcl-2 and lower production of ammonia, exhibited good anti-apoptosis quality and higher interferon-beta production in continuous culture.
Animals ; Apoptosis ; genetics ; physiology ; Biopharmaceutics ; CHO Cells ; cytology ; metabolism ; Cricetinae ; Cricetulus ; Glutamate-Ammonia Ligase ; genetics ; metabolism ; Interferon-beta ; metabolism ; Models, Genetic ; Proto-Oncogene Proteins c-bcl-2 ; genetics ; metabolism

Chinese hamster ovary cells (CHO) are preferable to prokaryotic, yeast or insect cells as hosts for biopharmaceutical production due to the products are more similar to their natural conformation. However, CHO cells confront tremendous difficulties when cultured in large scale such as mal-adaptation to serum-free medium, apoptosis and over-growth without limitation. So in addition to optimizing CHO system in respect of medium, environment and expression vector, modification of CHO cells themselves has drawn more and more attention. Here the main progress in CHO-modification is reviewed.
Animals ; Apoptosis ; genetics ; CHO Cells ; drug effects ; metabolism ; Cell Cycle ; drug effects ; Cell Cycle Proteins ; drug effects ; Cell Division ; drug effects ; Cricetinae ; Genetic Vectors ; genetics ; Transfection

A reasonable method for the quality control of tablets of Ginkgo biloba leaves was established in this paper. The total flavonol glycosides and terpene lactones of G. biloba tablets were quantified by HPLC. Totally, 16 batches of the commercially available tablets of G. biloba leaves were determined. Among of them, 2 batches were unqualified in the content of total flavonol glycosides, and 3 batches were unqualified in the content of terpene lactones. A validated HPLC fingerprint method was established to evaluate the commercially available tablets of G. biloba leaves with the assistance of LC-MS. Sixteen batches showed the similarity of 0.763-0.989. There were 31 fingerprint chromatogram peaks were identified as flavonoids compositions by LC-MS. This provides a research idea for the quality control of tablets of G. biloba leaves.
Chromatography, High Pressure Liquid ; methods ; Drugs, Chinese Herbal ; chemistry ; Ginkgo biloba ; chemistry ; Mass Spectrometry ; methods ; Plant Leaves ; chemistry ; Quality Control ; Tablets ; chemistry