Aim The purpose of this study was to compare the differential expression of 15-lipoxygenase isoenzymes in the pulmonary arteries between normoxia and hypoxia and to explore their roles in the formation of hypoxic pulmomary vasoconstriction. Method Eighteen SD rats were randomly divided into two groups(n=9):the normoxic control group breathing fresh gas and the hypoxic group breeding in animal hypoxic incubator.Immunohistochemical method,in situ hybridization and Western blot were employed to determine certain 15-lipoxygenase isoenzymes which involved in the process of hypoxic pulmonary vasoconstriction.Results ①In normoxic control group,the expression of 15-LO-1 protein was detected in the pulmonary arteries;but the expression of 15-LO-2 protein wasn’t detected.②The expression of 15-LO-1 protein in hypoxic group was much stronger than that in normoxic group (P

BACKGROUND: More recently,repair of skull defect with computer-designed prosthesis contributes to the revolutionary development of skull reconstruction technique. OBJECTIVE: To individually molded titanium mesh by computer-aided design (CAD) technique,and to observe the clinical application value of the titanium mesh in the repair of large-area skull defects in the fronto- temporo-parietal lobes. DESIGN,TIME AND SETTING: A retrospective case analysis was performed at the Department of Neurosurgery,Liuzhou People's Hospital between January 2006 and August 2007.PARTICIPANTS: A total of 16 patients comprising 12 males and 4 females,aged 16-52 years,suffered from skull defects in the fronto-temporo-parietai lobes following standard large trauma craniotomy and were recruited into this stud Two of these patients were complicated by hydrocephalus and received ventriculoperitoneal shunt. Skull defect area ranged between 9. 2 cm ×11.2 cm and 12.2 cm×14.6 cm. Skull defect neoplasty was performed in all patients 3-8months following standard large trauma craniotomy. METHODS: Titanium mesh patches were individually modeled by CAD,computer-aided manufacturing (CAM) and rapid shaping techniques and implanted into skull defect region. In addition,defect edge was fastened with titanium nails. MAIN OUTCOME MEASURES: Moulding effects and complications following skull defect neoplasty. RESULTS: A small amount of subcutaneous effusion was found in one patient and disappeared after liquid extraction and pressure dressing. Titanium mesh was firmly fixed with no loosening. Patients exhibited left-right symmetry,appropriate lateral curvature,no irregular umbilication or chewing dysfunction. All patients were followed for 3-18 months postoperatively and were satisfied with good resuRs,Le.,no complications,infection,material exposure,loosening,or collapse. CONCLUSION: CAD technique used for repair of skull defects is convenient,effective,and safe. This method can. reduce postoperative complications and improve repair effects.

The study is to develop a method to determine 3 batches leaves of Nauclea officinalis and stems of N. officinalis by HPLC. The differences between strictosamide contents and fingerprints was compared, then chromatographic peak of fingerprints was validated with the assistance of LC-MS. The strictosamide contents in stems of N. officinalis were higher than leaves of N. officinalis. The main chemical composition in leaves of N. officinalis and stems of N. officinalis were alkaloid which revealed by LC-MS. There are 7 chemical compositions were same between them, but the chemical composition in leaves of N. officinalis is more than stems of N. officinalis. This provides a scientific basis for the development of the potential medicinal value of leaves of N. officinalis and the sustainable utilization of N. officinalis.
Chromatography, High Pressure Liquid ; Drugs, Chinese Herbal ; chemistry ; isolation & purification ; Molecular Structure ; Plant Leaves ; chemistry ; Plant Stems ; chemistry ; Rubiaceae ; chemistry ; Spectrometry, Mass, Electrospray Ionization

AIM To investigate the improving effect of Suoquan Capsules (Linderae Radix,Alpiniae oxyphyllae Fructus and Dioscoreae Rhizoma) on mice with diabetic cystopathy and its mechanism of action.METHODS Sixty mice were randomly assigned into normal group (n =8) and model group (n =52);the diabetic models of the latter were induced by high-fat feeding combined with streptozotocin (STZ) injection,then modeled mice (n =32) were randomly divided into model,Mecobalamin Tablets,low-and high-dose Suoquan Capsules groups.The influences of Suoquan Capsules on fasting blood glucose (FBG),glycated serum protein (GSP) level and general conditions were observed.The bladder leak point pressure (BLPP) was determined.Histopathological staining was performed on urinary bladder.And the expressions of substance P and NK1 receptor were detected by double immunofluorescent staining.RESULTS There were no significant differences in FBG,GSP,body weight,food intake and water consumption among various groups.The high-dose Suoquan Capsules significantly decreased urine volume of mice.Compared with the model group,the treatment with Suoquan Capsules markedly increased BLPP,the expressions of substance P and NK1 receptor were significantly increased,and the histopathology of bladder in mice was obviously improved.CONCLUSION Suoquan Capsules improves the diabetic cystopathy in mice,and its mechanism maybe related to the up-regulation of substance P and NK1 receptor expressions in bladder tissue.

Serum used widely in mammalian cell culture is also a potential source of bacterial, mycoplasmal and viral contaminations. In addition, the complex biological components in serum make harder the subsequent product recovery process. High cost, high batch variation and potential source limitation are among the other shortcomings. So serum-free or even protein-free medium are preferable for recombinant protein production. However, without serum to provide essential components such as hormones, growth factors and binding proteins, cells are easy to die. In this study, CHO-dhfr- cells were genetically engineered to make them adapted to IMEM, a protein-free medium, and resistant to apoptosis. The genes in choice are insulin-like factor (Igf-1), Bcl-2 and cyclin E. Bcl-2 is a mitochondrial membrane-integrated protein. It can block the release of cytochrome c by maintaining the integrity of mitochondrial membrane, and thus inhibit apoptosis. Igf-1 is similar both in structure and function to insulin, a growth factor added to serum-free medium to promote cell growth and is the only protein component in many currently used serum-free media. cyclin E is a cell cycle protein expressed continuously in G1 phase. When cyclin E accumulates to certain amount, cell cycle was driven to S phase. So cyclin E is a proliferation-promoting protein. By co-express Igf-1/Bcl-2 or Bcl-2/ cyclin E in CHO-dhfr- cells with a dicistronic expression vector, we constructed two cell lines: CHO-IB and CHO-BC. The high expression of each protein was confirmed by Western blot and flow cytometry. Apoptosis was analyzed by flow cytometry and DNA ladder detection, and the two cell lines were both found much more resistant to apoptosis induced by withdrawal of serum or addition of actinomycin D than the CHO-dhfr- parent cell. Cell proliferation assay by MTT method showed that the two cell lines proliferated much faster than CHO-dhfr- in IMDM medium without serum. Continuously culture assay proved that the two cell lines grow very well in IMEM protein-free medium supplemented with fibronectin and vitronectin to ease adherence. When compared to CHO-dhfr-, the two cell lines exhibited much more viable cell numbers and faster growth rate.
Animals ; Apoptosis ; CHO Cells ; Cloning, Molecular ; Cricetinae ; Cricetulus ; Culture Media ; Cyclin E ; genetics ; Genes, bcl-2 ; Insulin-Like Growth Factor I ; genetics

A reasonable method for the quality control of tablets of Ginkgo biloba leaves was established in this paper. The total flavonol glycosides and terpene lactones of G. biloba tablets were quantified by HPLC. Totally, 16 batches of the commercially available tablets of G. biloba leaves were determined. Among of them, 2 batches were unqualified in the content of total flavonol glycosides, and 3 batches were unqualified in the content of terpene lactones. A validated HPLC fingerprint method was established to evaluate the commercially available tablets of G. biloba leaves with the assistance of LC-MS. Sixteen batches showed the similarity of 0.763-0.989. There were 31 fingerprint chromatogram peaks were identified as flavonoids compositions by LC-MS. This provides a research idea for the quality control of tablets of G. biloba leaves.
Chromatography, High Pressure Liquid ; methods ; Drugs, Chinese Herbal ; chemistry ; Ginkgo biloba ; chemistry ; Mass Spectrometry ; methods ; Plant Leaves ; chemistry ; Quality Control ; Tablets ; chemistry

Objective: To observe the effect of coxsackie virus B3 on airway tract and lung morphology, and to study the relation between CVB infection and asthma. Methods: We established CVB3 infective model: 5 d neonatal rats inhaled CVB3 by ultrasonic brume. CVB3-IgM was examined 10 d after inoculating of CVB3, and LW/BW, airway tract and lung pathological change 10 d and 30 d after inoculation of CVB3 were observed. Results: Rats from the virus group had higher D of CVB3-IgM than control's (+2s ) and had higher LW/BW 10 d after inoculation of CVB3 than control (P<0.01). Neonatal rats had acute inflammatory changes 10 d after inoculation of CVB3 and persistent changes in morphology and cytology. Conclusion: Neonatal rats virus model is established. Respiratory infection by CVB3 in neonatal rats has persistent changes in airway tract inflammatory and morphology.

OBJECTIVEMolecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.

METHODSSeven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.

RESULTSThe FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.

CONCLUSIONA novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.

Alleles ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; Ethnic Groups ; genetics ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Pedigree ; Phenotype ; Polymerase Chain Reaction ; Sequence Analysis, DNA ; Serologic Tests

Chinese hamster ovary cells (CHO) are preferable to prokaryotic, yeast or insect cells as hosts for biopharmaceutical production due to the products are more similar to their natural conformation. However, CHO cells confront tremendous difficulties when cultured in large scale such as mal-adaptation to serum-free medium, apoptosis and over-growth without limitation. So in addition to optimizing CHO system in respect of medium, environment and expression vector, modification of CHO cells themselves has drawn more and more attention. Here the main progress in CHO-modification is reviewed.
Animals ; Apoptosis ; genetics ; CHO Cells ; drug effects ; metabolism ; Cell Cycle ; drug effects ; Cell Cycle Proteins ; drug effects ; Cell Division ; drug effects ; Cricetinae ; Genetic Vectors ; genetics ; Transfection