OBJECTIVETo study the overexpression of Sox9 gene on rabbit bone marrow mesenchymal stem cells for repairing articular cartilage injury in vivo.

METHODSRabbit bone marrow mesenchymal stem cells (BMSCs) were transduced with lentivirus vector containing Sox9 gene and then cartilage specific molecule was detected by RT-PCR in vitro. Total 48 knee joints of 24 mature New Zealand white rabbits were randomly divided into 3 groups according to different defect treatment. After animals anesthesia,a full-thickness cylindrical cartilage defect of 4 mm diameter and 3 mm deep was created in the patellar groove using a stainlesssteel punch. Meanwhile, the transfected cells were implanted to repair the rabbit model with full-thickness cartilage defects. Cartilage defects tissue was observed with light microscope, electron microscope, HE and immunohistochemistry staining to assess the repair of defects by the complex at 6 weeks or 12 weeks after the implantation.

RESULTSAt 3 days after the transfection, Sox9 gene expression was highest and Sox9 gene expression decreased with the increase of time. At 3 days after the transfection, the expression of collagen type II began and reached the peak at 14 days. It showed that the bone marrow mesenchymal stem cells went into chondrogenic differentiation after transfected by Sox9 gene. Histological observation showed that at 6 weeks after the operation, the defects in the experimental group was filled with hyaline like cartilage tissue, 12 weeks after operation,the defects of cartilage and subchondral bone had satisfactory healing. Both at 6 and 12 weeks postoperatively, the defects were filled with fibrous tissues in control groups. Meanwhile, immunohistochemical staining of sections with type II collagen antibodies showed the proteins in the regenerated tissue stained positive for type II collagen and stronger than the control groups. The histological scoring system indicated that the cartilage repair of experiment groups were better than the two control groups with statistical significances.

CONCLUSIONOverexpression of Sox9 gene on rabbit bone marrow mesenchymal stem cells (BMSCs) promote the repair of cartilage defect.

Animals ; Bone Marrow Cells ; metabolism ; Bone Marrow Transplantation ; Cartilage, Articular ; injuries ; metabolism ; Cell- and Tissue-Based Therapy ; Female ; Genetic Vectors ; genetics ; metabolism ; Humans ; Lentivirus ; genetics ; metabolism ; Male ; Mesenchymal Stem Cell Transplantation ; Mesenchymal Stromal Cells ; metabolism ; Osteoarthritis ; genetics ; metabolism ; therapy ; Rabbits ; SOX9 Transcription Factor ; genetics ; metabolism ; Tissue Engineering

OBJECTIVETo investigate the effects of free and pedicled thoracodorsal artery perforator (TDAP) flaps for repairing skin and soft tissue defects in limbs, neck, axillary and shoulder.

METHODSFrom October 2009 to Auguest 2011, 16 TDAP flaps were used to repair skin and tissue defects. Among them, five ipsilateral pedicled flaps were used to repair wounds in neck, axillary and shoulder. 11 free TDAP flaps were used to repair the wounds with bone or tendon exposure. In 12 cases, the flaps were pedicled with thoracodorsal artery and vein-lateral branches-perforators, in 4 cases, pedicled with thoracodorsal artery and vein-serratus anterior muscular branches-perforators. The deep fascia, the latissimus dorsi and thoracodorsal nerve were not included in all flaps. The flaps size ranged from 10 cm x 5 cm to 26 cm x 10 cm.

RESULTSAll 16 flaps survived completely with primary healing both at donor site and recipent area. After a follow-up of 3 to 24 months, all flaps gained good texture and appearance. Only linear scar was left at donor area. The shoulder could move freely.

CONCLUSIONSTDAP flap has good texture, long vascular pedicle,and reliable blood supply, leaving less morbidity at donor site. The latissimus dorsi and thoracodorsal nerve are also preserved. The pedicled TDAP flap is an ideal flap for repairing the ipsilateral skin and soft tissue defects of the neck, shoulder, axillary. The free TDAP flap is suited for repairing skin and soft tissue defects of the extremities.

Arteries ; Axilla ; Humans ; Muscle, Skeletal ; Perforator Flap ; transplantation ; Surgical Flaps ; blood supply ; transplantation ; Thoracic Wall ; Wound Healing ; Wounds and Injuries ; surgery

OBJECTIVETo evaluate the outcomes after pylorus-preserving gastrectomy (PPG) for early gastric cancer(EGC).

METHODSClinicopathologic data of 52 patients with EGC undergoing PPG between August 1995 and December 2005 were analyzed retrospectively. A total of 159 patients of EGC who underwent distal gastrectomy with lymph node dissection(control group) were compared with those who received PPG.

RESULTSThe lymph node metastasis rate of EGC was 9.6% in PPG group, including 9.6% in No.3, 3.9% in No.4, 3.9% in No.6, and 3.9% in No.7. In the control group, the lymph node metastasis rate was 17.0%, including N1(14.5%) and N2(2.5%). There were no significant differences between the PPG group and the control group (P>0.05). In the PPG group, D1 dissection was 25%, D1+α was 25%, D1+β was 34.6%, and D2 was 15.3%. In control group, 121 patients(76.1%) had less than D2 dissection, while there were 33(20.7%) D2, and 5(3.1%) D3, and the difference was not statistically significant(P>0.05). There were no significant differences between the two groups in overall 5-year survival rate(92.3% vs. 93.1%, P=0.881). The 5-year survival rate in the PPG group was 100% for D1, 92.3% for D1+α, 88.9% for D1+β, and 85.7% for D2, while the 5-year survival rate in the control group was 92.3% for D1, 93.3% for D1+α, 91.7% for D1+β, and 93.9% for D2. The difference was not statistically significant(P>0.05). The recurrence rate was comparable (5.7% vs. 5.6%, P>0.05).

CONCLUSIONPylorus-preserving gastrectomy may provide long-term survival benefits for patients with early gastric cancer.

Adult ; Aged ; Female ; Follow-Up Studies ; Gastrectomy ; methods ; Humans ; Male ; Middle Aged ; Pylorus ; surgery ; Retrospective Studies ; Stomach Neoplasms ; surgery ; Treatment Outcome ; Vagus Nerve ; surgery

OBJECTIVETo analyse the diagnostic and therapeutic aspects of carotid body tumor (CBT).

METHODSSeven patients with CBT had been hospitalized between 2003 and 2006. The clinical data was analyzed retrospectively. The preoperative evaluation included angiography in 7 patients. Most of them had an asymptomatic cervical lateral mass. Only one patient had the hoarseness and buckling and was given radiation therapy alone. Six of seven patients with carotid body tumour underwent surgery. Simple tumor excision was accomplished in 4. Carotid artery resection with the tumor was required in 2 patients and in the both, interposition of a 7 mm polytetrafluoroethylene graft was performed . During the resection, temporary carotid shunt was required in the two patients.

RESULTSAll tumors by surgery were identified as carotid paragangliomas without evidence of malignancy. There was no mortality and no hemiplegia. After surgery, temporary cranial nerve dysfunction was noted in one case. In the follow-up period of 2 months to 2 years, no recurrent disease occurred. The patient's tumor who accepted radiotherapy was in the stable stage under the half year follow up, and the follow up would be further continued.

CONCLUSIONSWith non-invasive investigation and arteriography it was possible to obtain an early and precise diagnosis. The surgical management was the major treatment of these tumors. The pattern of operation should be chosen according to the relation of tumor and carotid. The decision to perform simple tumor excision or additional arterial resection was based on diagnostic preoperative and after the arterial resection the polytetrafluoroethylene graft would be used for carotid reconstruction.

Adult ; Blood Vessel Prosthesis ; Blood Vessel Prosthesis Implantation ; Carotid Body Tumor ; diagnosis ; surgery ; Female ; Humans ; Male ; Middle Aged ; Retrospective Studies

Objective To assess the effective length of jejunal graft when the 3~(rd) intestinal artery is u- tilized as vascular pedicle and afford a reliable theoretic base for clinical esophageal reconstruction.Methods In 32 formalin preserved and 21 fresh cadaver specimens,the diameter of 1st to 5th intestinal arteries and diameter of arterial arches are measured with linear calibre.Measure the length of jejunum that can be harves- ted as graft when the arches are extended.In the 21 fresh specimens,the 1st,2nd,4th and 5th intestinal ar- teries are ligated,acetic ester stained with red dye were injected into the lumen of 3rd intestinal artery via catheter.Extent of distribution of the arteries to the jejunum was observed.And then red ABS solution was in- jected into the 3rd intestinal artery to make into cast specimen.The blood supply distribution of jejunum through 3rd intestinal artery-arterial arch and communicating system were observed again.Results The di- ameter of the 3rd intestinal artery was the largest among the 1st to 5th intestinal arteries.The length of jejunum vascularized by 3rd intestinal artery can be as long as (142.2?62.3) (69.0～206.60cm) in acetic ester in- filtrated specimens.While in ABS east specimen,the average available extent of donor jejunum was(30.8?7.3) (23.0～37.3cm).Conclusion As observed by this applied anatomy study,the jejunum graft vascu- larized by 3rd intestinal artery alone has sufficient length to meet the need of esophageal reeonstrution.

Objective To study the clinical value of color Doppler ultrasonography in typing tuberculous epididymitis.Methods The appearances of color Doppler ultrasound and the findings on operation were analysed in 33 patients with tuberculous epididymitis.Results Of the 33 patients,epididymis appeared as diffusely and heterogeneously enlarged lesions with increased flow in 2 cases,appeared as nodular lesions in 13 cases including nodi with echofree space in 3 cases, nodi with high-level echo patches in 3 cases, and low echo-level nodi in 7 cases. Multiple lesions in scrotum were detected in 17 cases, of whom epididymis up to 11 cases appeared as diffusely enlarged heterogeneous lesions with flow increased.The sonographic appearancs of tuberculous epididymitis could be divided into 3 types:diffusion type, nodus type and complicated type. Nodus type included 3 subtypes: purulence type, calcification type, and cheese type.The accuracy rate of ultrsound diagnosis was 87.9%.Conclusions Testis is easy to be involved when epididymitis appears as diffusion type, so surgical treatments should be early.Purulence type and complicated type need surgical treatments while calcification type does not. Antituberculous drug treatments can be tried before surgical treatments in cheese type.Sonography of urinary system is helpful for the diagnosis of asymptomatic tuberculosis in urinary system when tuberculous epididymitis is first suspected on sonography.

Objective To determine the expression of membrane-bound B lymphocyte stimulator (BLyS) protein and its mRNA in vitro of peripheral blood mononuclear cells (PBMCs) from individuals with systemic lupus erythematosus (SLE),and to investigate the role of interferon-?(IFN-?) on the expression of BLyS.Methods PBMCs were obtained from 25 SLE patients (mean age of 31+14) and 20 healthy volunteers (mean age of 28?10).They were randomized into IFN-?(5 ng/ml) group and control group.PBMCs were col- lected at 0,6,12 and 24 h for BLyS mRNA assessment using semi-quantitative reverse transcription-PCR (RT-PCR).PBMCs were also collected at 72 h for membrane-bound BLyS protein detection using flow cy- tometry (FACS) and direct immunofluorescence.Results①The expression of BLyS mRNA and membrane- bound protein in PBMCs was significantly higher in individuals with SLE compared with healthy controls (P＜0.05);②IFN-?enhanced BLyS mRNA expression in PBMCs in both healthy controls and SLE patients,with the greatest effect at 6 h (stimulated vs unstimulated,0.42?0.19 vs 0.25?0.14,P＜0.01;0.59?0.28 vs 0.44?0.21,P＜0.01 );③IFN-?also increased the expression of membrane-bound BLyS protein in both healthy con- trols and individuals with SLE (FACs,mean fluorescence intensity,4.5+3.0 vs 3.7~2.6,P

OBJECTIVEMolecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.

METHODSSeven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.

RESULTSThe FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.

CONCLUSIONA novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.

Alleles ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; Ethnic Groups ; genetics ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Pedigree ; Phenotype ; Polymerase Chain Reaction ; Sequence Analysis, DNA ; Serologic Tests

OBJECTIVETo explore the pattern of lymph node metastasis and to determine a rational approach of surgery for early gastric cancer (EGC).

METHODSBetween January 1994 and January 2008, 165 patients with EGC were given D2 or over dissection. Clinicopathologic data of this group was analyzed retrospectively.

RESULTSThe lymph node metastasis rate was 3.8% in mucosa carcinoma (m-carcinoma), and was limited in first-tier; it was 25.7% in submucosa carcinoma (sm-carcinoma) and metastasized to second-tier and third-tier. Lymph node metastasis rate of EGC in u-region was low and was only limited in first-tier. But, in L-region, second- and third-tier lymph node metastasis was found in 5.2% and 0.9% of the patients, respectively. Second-tier lymph node metastasis was found in No. 7, 8, 9 and third-tier in No. 12, 14V, 16. The tumor size and lymph node metastasis was related closely, the lymph node metastasis only involved first-tier in m-carcinoma with a diameter < 5 cm, but the second-tier was involved in all sm-carcinoma. Significant difference was found in survival depending on the grade of tumor invasion: the cumulative 5-year survival rate was 97.3% in the m-carcinoma and was 87.6% in the sm-carcinoma (P = 0.019). There was no significant difference in survival between the extents in lymph node dissection (D2 93.8%, D3 91.7%) (P = 0.677).

CONCLUSIONSD2 and D2+ lymph node dissection is necessary for sm-early gastric cancer. A less radical approach could be applied to m-early gastric cancer in the u-region with a diameter < 2 cm.

Adult ; Aged ; Female ; Follow-Up Studies ; Humans ; Lymph Node Excision ; Lymph Nodes ; pathology ; Lymphatic Metastasis ; pathology ; Male ; Middle Aged ; Retrospective Studies ; Stomach Neoplasms ; pathology ; surgery ; Treatment Outcome

Objective To explore the imaging characteristics of hemiplegic patients with intractable epilepsy before and after modified hemispherectomy and their clinical significances.Methods The clinical data of 29 patients,admitted to and underwent hemispherectomy in our hospital from 1996 to 2010,were retrospectively analyzed.The characteristics ofpre-and post-surgical imaging of these patients were analyzed.Results Pre-surgical imaging showed that the crus cerebri of healthy lateral was enlarged for compensation and another lateral was atrophy with illed hemisphere.Hemispherectomy succeed in all the patients on the illed hemisphere; post-surgical imaging showed that operative cavity was reduced through healthy hemisphere shiftting to operative lateral,frontal sinus enlarging and skull becoming thickness.Follow-up was performed for 2-15 years; the disturbance of the nervous function was not worsened and there was no late complication in all the patients; Engel grading showed grade Ⅰ and Ⅱin 93.1％ patients and grade Ⅲ in 6.9％.Conclusion The CT/MR imaging is more valuable in localizing of the lesions as compared with EEG; the imaging changes before and after hemispherectomy can explain the shrunk cacity and few late complications.