Cloning, Molecular ; DNA ; genetics ; DNA-Binding Proteins ; genetics ; Humans ; Proteins ; genetics ; Sequence Analysis, DNA ; Two-Hybrid System Techniques ; Yeasts ; genetics

OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome. METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. CONCLUSION Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics* ; Child ; DNA Helicases/genetics* ; DNA-Binding Proteins/genetics* ; Genetic Variation ; Humans ; Mutation ; Phenotype

This study was aimed to explore the pathogenesis of type III familial hemophagocytic lymphohistiocytosis (FHL3) via susceptibility gene UNC13D involving in homologous recombination repair (HRR) of DNA double-strand break (DSB). By means of DNA homologous recombination repair, the change of homologous recombination repair rate of normal control cells and DR-U2OS cells after down-regulation of UNC13D was detected; the UNC13D gene related function was explored. The results showed that DR-U2OS cells displayed a significant reduction in homologous recombination repair of DNA DSB after siRNA knockdown of UNC13D, compared to its normal control cell counterparts (P < 0.05), suggesting that UNC13D was involved in DNA double-stranded breakage repair. It is concluded that UNC13D gene mutation may be involved in the pathogenesis of FHL3 via its dual effects of both the cytotoxic granule exocytosis and decrease of homologous recombination repair rate after the DNA double-strand break, therefore, providing a new theoretical basis to reveal the pathogenesis of FHL3.
DNA Breaks, Double-Stranded ; DNA-Binding Proteins ; genetics ; Humans ; Lymphohistiocytosis, Hemophagocytic ; classification ; genetics ; Membrane Proteins ; genetics ; Recombinational DNA Repair

Myelodysplastic syndrome (MDS) is clonal disorder of hematopoiesis characterized by inefficient hematopoiesis, peripheral blood cytopenias, aberrant differentiation, and risk of progression to acute myeloid leukemia. Although specific karyotypic abnormalities have been found to link to MDS for decades, more recent findings have demonstrated the importance of mutations within individual genes. The recent molecular abnormalities found in MDS include following gene mutation such as TET2, TP53, RUNX1, ASXL1, IDH1/IDH2, EZH2 and RAS. In this review, the recent advances of prognostic molecular markers of MDS and their biological and clinical significance are summarized.
DNA-Binding Proteins ; genetics ; Humans ; Mutation ; Myelodysplastic Syndromes ; diagnosis ; genetics ; Prognosis ; Proto-Oncogene Proteins ; genetics

DNA sensor, a kind of pattern recognition receptor (PRR), is widely expressed in innate immune cells. It activates the inflammatory signaling pathways and triggers an innate immune response by recognizing the pathogens or DNA in abnormal host cells. DNA-dependent activator of IFN-regulatory factors (DAI) is the first cytoplasmic DNA receptor discovered, which plays an important role in regulating the innate immune responses characterized by induction of interferon and programmed cell death. The article summarizes the molecular characteristics of DAI, its downstream signaling pathways, and its role and mechanism in anti-infective immunity, tumor immunity and inflammatory diseases. It also makes a preliminary exploration of the correlation between DAI and transplantation immunology, and provides a new target for the therapy of various immune diseases.
DNA/metabolism* ; Receptors, Pattern Recognition ; Immunity, Innate ; Signal Transduction/genetics* ; DNA-Binding Proteins/genetics*

Tet2 (the 2nd member of tet oncogene family) is a newly discovered antioncogene on the chromosome 4q24 of the patient with malignant myeloma, which has a potential for functional deletion. Recent studies demonstrated that tet2 mutation was found in polycythemia vera (PV), essential thrombocythemia (ET), myelofibrosis, systematic mastocytosis (SM), and myelodysplastic syndrome (MDS). However, a great number of perspective researches are still needed for exploring the role of tet2 in the pathogenesis of malignant blood diseases. In this review, the relation of tet2 mutation with myeloproliferative neoplasm, systemic mastocytosis, myelodysplastic syndrome, acute myeloid leukemia and other malignant blood diseases are summarized.
DNA-Binding Proteins ; genetics ; Hematologic Diseases ; genetics ; Humans ; Mutation ; Myelodysplastic Syndromes ; genetics ; Myeloproliferative Disorders ; genetics ; Proto-Oncogene Proteins ; genetics

No abstract available.
Asian Continental Ancestry Group/*genetics ; DNA-Binding Proteins/*genetics ; Female ; Humans ; Male ; Thyroid Neoplasms/*genetics

The aim of study was to establish the packaging system of the recombinant lentiviral vector encoding Gfi1 gene for eukaryotic expression and to realize the efficient, stable expression of Gfi1 32D cells so as to provide effective platform for further studying the development of Gfi1 gene in hematologic malignancies. The three-plasmid recombinant lentiviral vector consisting of transfer plasmid (pLOX-Gfi1/pLOX), the packaging plasmid (pCMVDeltaR8.2) and the envelop plasmid (pMD.G) was prepared and purified. Human embryonic kidney 293T cells were cotransfected with the three plasmids by lipofectamine 2000. After transfection for 48 hours, the viral supernatant was collected and the target cell 32D was transfected with the recombinant lentivirus; the Gfi1 integration and expression in 293T and 32D cells were detected by Western-blot. The results showed that the three plasmids of lentivirus could be transfected into 293T with high efficiency and packaged successfully, and the Gfi1 protein could be detected by fluorescent microscopy. The recombinant lentiviruses carrying Gfi1 could transfer and deliver Gfi1 gene to 32D cells, and the Gfi1 expression in 293T and 32D cell could be detected by Western blot. It is concluded that the recombinant lentivirus carrying Gfi1 can deliver target gene to 32D cells with high efficiency, and the expression of Gfi1 protein is stable in 32D.
Cell Line ; DNA-Binding Proteins ; genetics ; Genetic Vectors ; Humans ; Lentivirus ; genetics ; Plasmids ; Transcription Factors ; genetics ; Transfection

Charcot-Marie-Tooth Disease/genetics* ; DNA-Binding Proteins/genetics* ; Humans ; Mutation ; Transcription Factors/genetics*

OBJECTIVEExpress a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription.

METHODSWe express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction.

RESULTSThe plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15.

CONCLUSIONSkod-ssb may in future be used to enhance DNA and cDNA amplification.

Archaeal Proteins ; genetics ; isolation & purification ; metabolism ; Chromatography, Affinity ; DNA, Bacterial ; genetics ; metabolism ; DNA, Complementary ; genetics ; metabolism ; DNA-Binding Proteins ; genetics ; isolation & purification ; metabolism ; Gene Expression ; Thermococcus ; genetics ; metabolism