1.Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome.
Chinese Journal of Medical Genetics 2021;38(1):42-46
OBJECTIVE:
To explore the genetic basis for three children patients with CHARGE syndrome.
METHODS:
The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.
RESULTS:
All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.
CONCLUSION
Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics*
;
Child
;
DNA Helicases/genetics*
;
DNA-Binding Proteins/genetics*
;
Genetic Variation
;
Humans
;
Mutation
;
Phenotype
2.Overexpression, purification and helicase activity analysis of recombinant human PIF1 protein.
Chinese Journal of Biotechnology 2009;25(2):268-273
Pif1 subfamily helicase is conserved from yeast to humans with a lot of cellular functions. In order to elucidate the function of human PIF1 helicase from biochemical level, we cloned human PIF1 gene by PCR from HeLa cell cDNA library. We co-transformed a pMStRNA1 plasmid encoding rare tRNA codons and a plasmid encoding molecular chaperon to greatly enhance the overexpression of human PIF1 protein. Finally we purified full-length PIF1 helicase by column chromatograph carried out at 4 degrees C using fast protein liquid chromatograph (FPLC) system. The human PIF1 protein was purified in enough quantity for detailed biochemical analysis. Biochemical assay showed that PIF1 had ATPase activity and helicase activity. The purification and biochemical properties analysis of human PIF1 helicase will allow us to understand how, at the molecular and mechanistic level, this conserved helicase operates in the cell.
DNA Helicases
;
biosynthesis
;
genetics
;
metabolism
;
HeLa Cells
;
Humans
;
RNA, Transfer
;
genetics
;
Recombinant Proteins
;
biosynthesis
;
genetics
;
metabolism
3.Clinical and genetic analysis of two patients with CHARGE syndrome due to de novo variants of CHD7 gene.
Yan DONG ; Xiaoyi SHI ; Kaixian DU ; Yali SHI ; Jun WANG ; Tianming JIA ; Ke ZHANG ; Ruijuan XU ; Lijun WANG
Chinese Journal of Medical Genetics 2022;39(4):387-391
OBJECTIVE:
To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome.
METHODS:
The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents.
RESULTS:
Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype.
CONCLUSION
The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.
CHARGE Syndrome/genetics*
;
DNA Helicases/genetics*
;
DNA-Binding Proteins/genetics*
;
Genetic Testing
;
Heterozygote
;
Humans
;
Mutation
;
Phenotype
;
Whole Exome Sequencing
4.Genetic analysis of two children patients affected with CHARGE syndrome.
Guoqiang LI ; Niu LI ; Yufei XU ; Juan LI ; Yu DING ; Yiping SHEN ; Xiumin WANG ; Jian WANG
Chinese Journal of Medical Genetics 2018;35(2):244-247
OBJECTIVETo analyze two Chinese pediatric patients with multiple malformations and growth and development delay.
METHODSBoth patients were subjected to targeted gene sequencing, and the results were analyzed with Ingenuity Variant Analysis software. Suspected pathogenic variations were verified by Sanger sequencing.
RESULTSHigh-throughput sequencing showed that both patients have carried heterozygous variants of the CHD7 gene. Patient 1 carried a nonsense mutation in exon 36 (c.7957C>T, p.Arg2653*), while patient 2 carried a nonsense mutation of exon 2 (c.718C>T, p.Gln240*). Sanger sequencing confirmed the above mutations in both patients, while their parents were of wild-type for the corresponding sites, indicating that the two mutations have happened de novo.
CONCLUSIONTwo patients were diagnosed with CHARGE syndrome by high-throughput sequencing.
CHARGE Syndrome ; genetics ; DNA Helicases ; genetics ; DNA-Binding Proteins ; genetics ; Genetic Testing ; High-Throughput Nucleotide Sequencing ; Humans ; Infant ; Male ; Mutation
6.Gastric SWI/SNF complex deletion-associated undifferentiated carcinoma with rhabdoid phenotype: a clinicopathological and molecular analysis.
Yi Ping JIN ; Lu WANG ; Yi WANG ; Dao Yuan WU ; He ZHANG ; Qing Xin XIA
Chinese Journal of Pathology 2022;51(12):1229-1234
Objective: To investigate the clinicopathological features and molecular genetic characteristics of gastric SWI/SNF complex deletion-associated undifferentiated carcinoma with rhabdoid phenotype. Methods: Six cases of gastric SWI/SNF complex deletion-associated undifferentiated carcinoma with rhabdoid phenotype diagnosed at the Henan Cancer Hospital, Zhengzhou, China from January 2019 to December 2021 were collected. Histological observation, immunohistochemical staining, next-generation sequencing, and detection of mismatch repair (MMR), EBER, and HER2 were performed. The clinicopathological and molecular characteristics were summarized and relevant literatures were reviewed. Results: The 6 patients were all male, aged 48-75 years. Their initial symptoms mainly included abdominal pain, melena, and dysphagia. Endoscopic examinations showed gastric ulcer type masses, and the morphology of H&E were similar: the tumor cells showed diffuse infiltrating growth, no specific structural characteristics, obvious cell atypia, obvious mitoses, and rhabdomyoid cells with unequal proportions of eosinophilic cytoplasm. The immunohistochemistry for CKpan was negative in 3 of the 6 cases, while focal expression of other epithelial markers was found, including EMA (6/6), CK8/18 (4/6), and CK7 (1/6). P53 was diffusely strong positive in 4 cases (4/6), and negative in 1 case (1/6). Ki-67 was highly expressed (positive rate range, 60%-90%). Other related markers such as mesenchymal tumors, lymphoma, melanoma and germ cell tumors were all negative. Detection of the SWI/SNF complex subunit, namely INI1 (SMARCB1), BRG1 (SMARCA4), ARID1A protein detection, was detected in 5 cases with no SMARCA4 expression (5/6), 1 case with no ARID1A expression (1/6), and all cases with SMARCB1 expression (6/6). MMR proteins were examined, and dMMR was found in 1 of the 6 cases. HER2 expression was 0 in 3 cases, 1+ in 1 case, and 2+ in 2 cases, while no amplifications of HER2 gene were detected using FISH. EBER was negative in all 6 cases. Among the 4 cases of surgical radical treatment that were subject to next-generation sequencing, 3 cases showed TP53 mutations; 1 case showed ARID1A gene frame shift mutation, and there were also mutations of ATM, PTEN and other genes. There was 1 case with detected SMARCA4 gene copy number variant, and other gene mutations such as ALK, BRAF, CDKN1B, BRCA2, etc. Conclusions: Gastric SWI/SNF complex deletion-associated undifferentiated carcinoma with rhabdoid phenotype is a poorly differentiated and rare tumor. Detection of SWI/SNF complex related proteins is helpful for its diagnosis. Moreover, gene mutations associated with SWI/SNF complex will become a new indicator for its diagnosis and prognostication, and a potential new target for molecular therapy, which deserves more attention and warrants more research.
Humans
;
Male
;
Carcinoma/genetics*
;
China
;
DNA Helicases/genetics*
;
Nuclear Proteins/genetics*
;
Transcription Factors/genetics*
;
Phenotype
;
Middle Aged
;
Aged
7.Diagnosis a fetus with Coffin-Siris syndrome due to variant of SMARCA4 gene by whole exome sequencing.
Youwei BAO ; Xiaoli PAN ; Shuqing PAN ; Lisha GE ; Danyan ZHUANG ; Haibo LI
Chinese Journal of Medical Genetics 2022;39(12):1375-1378
OBJECTIVE:
To explore the clinical phenotype and genetic basis for a fetus suspected for Coffin-Siris syndrome.
METHODS:
Chromosomal microarray analysis (CMA) and whole exome sequencing (WES) were carried out for the fetus. Candidate variant was verified by Sanger sequencing.
RESULTS:
Prenatal ultrasound at 23rd gestational week has revealed fetal ventriculomegaly. No abnormality was found by CMA, while WES revealed that the fetus has harbored a de novo heterozygous c.2851G>A (p.G951R) variant of the SMARCA4 gene, which was predicted to be pathogenic.
CONCLUSION
Genetic testing should be considered for fetuses featuring progressive widening of lateral cerebral ventricles.
Female
;
Humans
;
Pregnancy
;
DNA Helicases/genetics*
;
Fetus
;
Genetic Testing
;
Nuclear Proteins/genetics*
;
Phenotype
;
Transcription Factors/genetics*
;
Exome Sequencing
8.Analysis of Clinical Characteristics and Prognosis in Children with Acute Megakaryoblastic Leukemia without Down Syndrome.
Shao-Fen LIN ; Shu-Yi GUO ; Su LIU ; Jian WANG ; Ke HUANG ; Yang LI ; Jian-Pei FANG ; Dun-Hua ZHOU
Journal of Experimental Hematology 2021;29(2):374-380
OBJECTIVE:
To analyze the clinical characteristics and treatment effects of children with acute megakaryoblastic leukemia without down syndrome (non-DS-AMKL).
METHODS:
The clinical data of 19 children with non-DS-AMKL treated in the Pediatric Hematology Ward in Sun Yat-sen Memorial Hospital of Sun Yat-sen University from May 2008 to April 2018 were analyzed retrospectively. The clinical characteristics, laboratory test and treatment methods of the children were concluded. All patients were followed up to evaluate the effect of treatment.
RESULTS:
The 19 cases of children included nine male and ten female, the median age of onset was 2 years old. The clinical manifestations showed nonspecific. The median white blood cell of peripheral blood was 15.88×10
CONCLUSION
Non-DS-AMKL was rare in children and difficult to be diagnosed. Determination of MICM classification as early as possible was helpful for diagnosis, and genetic testing played an important role for diagnosis and prognosis evaluation. Early hematopoietic stem cell transplantation in patients with CR after chemotherapy might be an effective way to cure AMKL.
Child
;
Child, Preschool
;
DEAD-box RNA Helicases
;
DNA Helicases
;
Down Syndrome
;
Female
;
Humans
;
Leukemia, Megakaryoblastic, Acute/genetics*
;
Male
;
Prognosis
;
Retrospective Studies
;
Trisomy
9.Drosophila RecQ5 is required for efficient SSA repair and suppression of LOH in vivo.
Yixu CHEN ; Wen DUI ; Zhongsheng YU ; Changqing LI ; Jun MA ; Renjie JIAO
Protein & Cell 2010;1(5):478-490
RecQ5 in mammalian cells has been suggested to suppress inappropriate homologous recombination. However, the specific pathway(s) in which it is involved and the underlining mechanism(s) remain poorly understood. We took advantage of genetic tools in Drosophila to investigate how Drosophila RecQ5 (dRecQ5) functions in vivo in homologous recombination-mediated double strand break (DSB) repair. We generated null alleles of dRecQ5 using the targeted recombination technique. The mutant animals are homozygous viable, but with growth retardation during development. The mutants are sensitive to both exogenous DSB-inducing treatment, such as gamma-irradiation, and endogenously induced double strand breaks (DSBs) by I-Sce I endonuclease. In the absence of dRecQ5, single strand annealing (SSA)-mediated DSB repair is compromised with compensatory increases in either inter-homologous gene conversion, or non-homologous end joining (NHEJ) when inter-chromosomal homologous sequence is unavailable. Loss of function of dRecQ5 also leads to genome instability in loss of heterozygosity (LOH) assays. Together, our data demonstrate that dRecQ5 functions in SSA-mediated DSB repair to achieve its full efficiency and in suppression of LOH in Drosophila.
Animals
;
DNA Repair
;
genetics
;
DNA, Single-Stranded
;
genetics
;
Drosophila Proteins
;
genetics
;
metabolism
;
Drosophila melanogaster
;
genetics
;
metabolism
;
Loss of Heterozygosity
;
genetics
;
RecQ Helicases
;
genetics
;
metabolism
10.Mechanism involving blm gene underlies repair of DNA damage of Jurkat cells induced by mitomycin C.
Xue YI ; Hui CHENG ; Ping ZOU ; Ling-Bo LIU ; Ting ZHANG ; Dan YU ; Xiao-Ming ZHU ; Liang ZOU
Journal of Experimental Hematology 2010;18(5):1155-1158
The defect or block of apoptosis is an important factor involved in the drug resistance of tumor cells. Blm gene plays a great role in DNA damage and repair. This study was aimed to explore the relationship of blm gene expression with cell cycle and apoptosis after Jurkat DNA damage. The apoptosis rate and change of cell cycle were detected by flow cytometry, the expression level of blm mRNA in Jurkat cells was determined by semi-quantitative RT-PCR. The results indicated that after induction with 0.4 g/L of mitomycin C (MMC) for 24 hours the apoptosis rate of Jurkat cells were (11.42±0.013)%, and (66.08±1.60)% Jurkat cells were arrested in G2/M phase. After induction for 48 hours, the apoptosis rate of Jurkat cells declined from (11.42±0.013)% to (8.08±0.27)%, and cell count of Jurkat cells arrested in G2/M phase decreased from (66.08±1.60)% to (33.96±1.05)%. When induced with 0.4 g/L of MMC for 24 hours, the apoptosis rate of fibroblasts and the percentage of fibroblasts in G2/M, G0-G1 and S phase all showed no significant change until 48 hours. The range of apoptosis rate and the change of cell percentage in three phases were significantly different between Jurkat cells and fibroblasts (p<0.01). Expression level of blm mRNA in Jurkat cells was remarkably higher than that in normal fibroblasts (p<0.01), at 48 hours expression level of blm mRNA was remarkably higher than that at 24 hours. The 2 groups showed clear difference of blm mRNA expression after treated by MMC (p<0.01). It is concluded that the blm gene may play a significant role in repair of DNA damage of Jurkat cells after MMC induction. Abnormal expression of blm is correlated to the drug resistance of leukemia cells.
Apoptosis
;
Cell Cycle
;
DNA Damage
;
drug effects
;
DNA Repair
;
drug effects
;
Humans
;
Jurkat Cells
;
Mitomycin
;
pharmacology
;
RecQ Helicases
;
genetics