BACKGROUND: The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM. METHODS: A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM. RESULTS: Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses. CONCLUSION The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans ; Female ; Pregnancy ; Diabetes, Gestational/immunology* ; Prospective Studies ; Adult ; Inflammation/immunology* ; Glucose Tolerance Test ; Birth Cohort

Blood biochemical indicators are an important basis for the diagnosis and treatment by doctors. The performance of related instruments, the qualification of operators, the storage method and time of blood samples and other factors will affect the accuracy of test results. However, it is difficult to meet the clinical needs of rapid detection and early screening of diseases with currently available methods. Point-of-care testing (POCT) is a new diagnostic technology with the characteristics of instant, portability, accuracy and efficiency. Microfluidic chips can provide an ideal experimental reaction platform for POCT. This paper summarizes the existing detection methods for common biochemical indicators such as blood glucose, lactic acid, uric acid, dopamine and cholesterol, and focuses on the application status of POCT based on microfluidic technology in blood biochemistry. It also summarizes the advantages and challenges of existing methods and prospects for development. The purpose of this paper is to provide relevant basis for breaking through the technical barriers of microfluidic and POCT product development in China.
Humans ; Point-of-Care Testing ; Lactic Acid/blood* ; Microfluidic Analytical Techniques/methods* ; Blood Glucose/analysis* ; Point-of-Care Systems ; Blood Chemical Analysis/instrumentation* ; Uric Acid/blood* ; Cholesterol/blood* ; Dopamine/blood* ; Microfluidics/methods*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES

Gestational diabetes mellitus (GDM), a pregnancy-induced hyperglycemia, affects approximately 17% of pregnancies globally. Its pathophysiology remains unclear, with inflammation and vascular remodeling playing key roles. CD248, a glycoprotein linked to inflammation and vascular remodeling, has been implicated in various conditions, but its role in GDM is uncertain.

METHODOLOGY

A prospective case-control study was conducted with 169 pregnant women aged 18 to 49 at a tertiary hospital. Serum CD248 levels were assessed at 24 to 28 weeks of gestation prior to the oral glucose tolerance test (OGTT). Statistical analyses evaluated the association between CD248 levels, BMI and GDM status.

RESULTS

Of the participants, 32 (18.9%) were diagnosed with GDM. CD248 levels were lower in GDM patients (8.15 ± 10.16 ng/mL) than in controls (11.42 ± 15.44 ng/mL), but the difference was not statistically significant (p = 0.084). Although CD248 levels did not correlate with OGTT values, it was positively associated with BMI (pCONCLUSION

Unlike earlier findings associating elevated CD248 levels with early pregnancy GDM risk, this study found no significant relationship during later gestational stages. These results highlight a potentially complex and context-dependent role for CD248 in GDM pathophysiology.

Human ; Diabetes, Gestational ; Inflammation ; Glucose Tolerance Test

OBJECTIVES

Clinical pathways (CPs) ensure adherence to heart failure (HF) management guidelines. To optimize quality care in a low resource setting, an evidence-based care pathway for the management of acute HF was implemented at the emergency department (ED) of the Philippine General Hospital (PGH), the designated national tertiary hospital and referral center. This study aimed to describe the characteristics of adults with acute HF admitted at the ED and evaluate the quality of care they received, measured using physician adherence to the hospital’s acute heart failure CP.

METHODS

This was a retrospective, descriptive cohort study. We reviewed the inpatient charts of all adult patients with acute HF admitted to the ED of the PGH and referred to the Division of Cardiovascular Medicine between December 1, 2022 and May 31, 2023. Quality of care was assessed based on adherence to quality indicators adapted from routine and conditional order sets detailed in the pathway. Descriptive statistics was utilized to describe patient characteristics, quality of care, and outcomes.

RESULTS

Two hundred thirty-six (236) patients were included, with a mean age of 51.8 years. Majority were male (53.4%); hypertension (61.4%) and ischemic heart disease (53.8%) were the most common comorbidities, and infection the most common precipitant of decompensation (60.6%). There were optimal adherence rates to routine orders, which included referrals to Internal Medicine and Cardiology, baseline vital signs monitoring, fluid intake and output monitoring, chest radiograph, complete blood count, blood urea nitrogen, sodium, potassium, prothrombin time, partial thromboplastin time, arterial blood gas, urinalysis, and N-terminal pro b-type natriuretic peptide. Conditional orders, such as oxygen support, focused echocardiography, thyroid - stimulating hormone, and the use of vasopressors, diuretics, and venous thromboembolism prophylactic agents, were optimally performed when warranted. However, we noted suboptimal adherence to certain resource-intensive conditional orders, such as hourly monitoring of urine output (61.4%), hooking to cardiac monitor (53.8%), and performance of 12-lead ECG within 10 minutes (56.8%). Further, only 43.9% of patients were referred to the intensive care unit. Troponin I, calcium, magnesium, and albumin were ordered in excess.

CONCLUSION

Overall adherence rate of physicians to the hospital’s Acute Heart Failure Pathway was satisfactory. Work is needed to improve adherence to hourly urine output monitoring, consistent hooking to cardiac monitor, and timely performance of 12-lead ECG – an effort that begins with expanding in-hospital diagnostic equipment and human resource supply. We recommend continuous pathway implementation with periodic evaluation and stakeholder feedback to further improve quality of care.

Human ; Male ; Female ; Middle Aged: 45-64 Yrs Old ; Adult ; Albumins ; Blood ; Blood Urea Nitrogen ; Calcium ; Cardiology ; Chart ; Charts ; Cohort Studies ; Critical Care ; Critical Pathways ; Diagnostic Equipment ; Disease ; Diuretics ; Echocardiography ; Electrocardiography ; Emergencies ; Emergency Service, Hospital ; Equipment And Supplies ; Evaluation Studies As Topic ; Feedback ; Heart ; Heart Diseases ; Heart Failure ; Hormones ; Hospitals ; Hospitals, General ; Humans ; Hypertension ; Indicators And Reagents ; Infection ; Infections ; Inpatients ; Intensive Care Units ; Internal Medicine ; Lead ; Magnesium ; Male ; Medicine ; Myocardial Ischemia ; Natriuretic Peptide, Brain ; Natriuretic Peptides ; Nitrogen ; Overall ; Oxygen ; Partial Thromboplastin Time ; Patients ; Peptides ; Philippines ; Physicians ; Potassium ; Prothrombin ; Prothrombin Time ; Quality Of Health Care ; Referral And Consultation ; Sodium ; Statistics ; Tertiary Care Centers ; Thorax ; Thromboembolism ; Thromboplastin ; Thyroid Gland ; Time ; Troponin ; Troponin I ; Universities ; Urea ; Urinalysis ; Urine ; Venous Thromboembolism ; Vital Signs ; Work ; Workforce

OBJECTIVES

In Asia, younger individuals (below age 45) are diagnosed to have type 2 diabetes with increased rates of obesity defined by lower BMI yet with greater visceral adiposity (waist circumference and waisthip ratios). The prevalence data on type 1 diabetes is not well established, considered to be low, but is seen to be increasing as well. This changing phenotype therefore, presents a clinical dilemma in terms of correctly classifying diabetes and deciding on the consequent appropriate treatment. Distinguishing type 1 from type 2 diabetes has become more difficult with type 2 diabetes dramatically increasing in young adults and children. This study aims to define the characteristics of diabetes among young adults in the Philippines to provide a basis for appropriate management amidst changes in diabetes phenotypes seen globally.

METHODS

In this cross-sectional analytic study, we characterized the demographic, metabolic, and autoimmune features of diabetes among young adult Filipinos aged 18 to 45 years old consulting at a tertiary referral center in Manila, Philippines. Baseline serum A1c, FBS, 75-g oral glucose tolerance test, insulin, serum C-peptide, insulin autoantibodies, leptin, adiponectin, lipid profile, and thyroid function tests were obtained from the participants and analyzed. The homeostasis model assessment (HOMA) was used to estimate the insulin sensitivity.

RESULTS

A total of 348 patients with diabetes were included, with females comprising two-thirds of the participants. The mean age at diagnosis of diabetes was 35.9±7.22 years. The mean BMI was 28.12 kg/m2, with median waist to hip ratio (WHR) of 0·93. Metabolic syndrome was found in 60% of participants and 67.82% were obese by body mass index. The mean A1c was 9.07±2.52%. Good glucose control (A1c less than 7.0%) was seen in 23% of participants  while nearly half (48%) had HbA1c which was >9.0%. The median levels of fasting insulin and C-peptide were 12.62 (range 1.33–90.42) mIU/L and 0.78 ng/mL (range 0–16.2), respectively. 

Included participants were diagnosed with diabetes within a year and as such, majority did not have any micro- or macrovascular complications. The most common diabetes complication was sensory neuropathy detected by monofilament testing, which was found in 28% of participants, followed by non-proliferative diabetic retinopathy in 13%. A history of previous diabetic ketoacidosis was found in 10 patients (2.87%). Glutamic acid decarboxylase (GAD) and insulin auto-antibodies were found in 3.2% and 19.3% of participants, respectively. Approximately half (51.73%) of the participants were insulin resistant by HOMA-IR.

CONCLUSION

In contrast with Caucasians and other Asians, diabetes among young Filipino adults is associated with lower BMI but with a similarly high visceral adiposity as shown by an elevated WHR. Metabolic syndrome with insulin resistance as defined by a variety of indices is predominant. Type 1 diabetes with autoantibodies occur in only a small fraction of this population. Data derived from this work can provide a framework for cluster analysis towards personalized management specific to this population.

Human ; Acids ; Adiponectin ; Adiposity ; Adult ; Aged ; Antibodies ; Asia ; Asian ; Asian Continental Ancestry Group ; Autoantibodies ; Body Mass Index ; C-peptide ; Carboxy-lyases ; Child ; Cluster Analysis ; Demography ; Diabetes Complications ; Diabetes Mellitus ; Diabetes Mellitus, Type 1 ; Diabetes Mellitus, Type 2 ; Diabetic Ketoacidosis ; Diabetic Retinopathy ; Diagnosis ; Fasting ; Female ; Glucose ; Glucose Tolerance Test ; Glutamate Decarboxylase ; Glutamic Acid ; Insulin ; Insulin Resistance ; Ketosis ; Leptin ; Lipids ; Metabolic Syndrome ; Obesity ; Patients ; Peptides ; Phenotype ; Philippines ; Population ; Prevalence ; Serum ; Therapeutics ; Thyroid Gland ; Thyroid Function Tests ; Young Adult

Diabetes and its complications pose a serious threat to human life and health. It has become a public health problem of wide concern worldwide. Currently, diabetes is mainly treated with insulin injection in clinic. However, manual insulin injection still has many shortcomings. In recent years, with the deepening of research, it has been found that an automated insulin delivery system (AID), which combines a continuous glucose monitoring device with an insulin pump, can significantly improve the effectiveness of diabetes treatment and reduce the incidence of complications in patients. This paper firstly introduces the composition of the AID system and its working principle, and then details the development history and current status of the related technologies from the aspects of continuous glucose monitoring technology, insulin pumps and the development of closed-loop control algorithms, etc. Finally, this paper looks forward to the application prospect and future development of AID system in the field of diabetes treatment, providing theoretical reference for further research.
Humans ; Insulin Infusion Systems ; Insulin/administration & dosage* ; Blood Glucose Self-Monitoring/instrumentation* ; Diabetes Mellitus/drug therapy* ; Algorithms ; Hypoglycemic Agents/administration & dosage* ; Blood Glucose/analysis* ; Pancreas, Artificial ; Automation

OBJECTIVE: To explore the effects of veno-venous extra corporeal carbon dioxide removal (V-V ECCO₂R) on local mechanical power and gas distribution in the lungs of patients with mild to moderate acute respiratory distress syndrome (ARDS) receiving non-invasive ventilation. METHODS: Retrospective research methods were conducted. Sixty patients with mild to moderate ARDS complicated with renal insufficiency who were transferred to the respiratory intensive care unit (RICU) through the 96195 platform critical care transport green channel from January 2018 to January 2020 at the collaborative hospitals of Henan Provincial People's Hospital were enrolled. According to different treatment methods, they were divided into a conventional treatment group and an ECCO₂R group, with 30 patients in each group. Both groups received standard treatments including primary disease treatment, airway management, and non-invasive ventilation. The conventional treatment group received bedside continuous renal replacement therapy (CRRT), and the ECCO₂R group received V-V ECCO₂R treatment. General information of patient such as gender, age, cause of disease, and acute physiology and chronic health evaluation II (APACHE II) were recorded; arterial blood gas analysis was performed before treatment and at 12 hours and 24 hours during treatment, recording arterial partial pressure of oxygen (PaO₂), arterial partial pressure of carbon dioxide (PaCO₂), and oxygenation index (PaO₂/FiO₂). Respiratory mechanics parameters [tidal volume, respiratory rate, maximal inspiratory pressure (MIP), and maximal expiratory pressure (MEP)] were recorded, and the rapid shallow breathing index (RSBI) was calculated; electrical impedance tomography (EIT) was used to measure regional of interest (ROI) values in different lung areas at 12 hours and 24 hours of treatment, and the pulmonary mechanical energy was calculated. RESULTS: The arterial blood gas analysis indicators, respiratory mechanics parameters, and pulmonary mechanical energy of patients in the conventional treatment group and ECCO₂R group improved significantly after 24 hours of treatment compared to 12 hours of treatment (all P < 0.05). The levels of PaCO₂, RSBI, total mechanical power, and non-dependent zone mechanical power in the ECCO₂R group were significantly lower than those in the conventional treatment group at both 12 hours and 24 hours during the treatment [PaCO₂ (mmHg, 1 mmHg ≈ 0.133 kPa): 44.03±2.96 vs. 49.96±2.50 at 12 hours, 41.65±3.21 vs. 48.53±2.33 at 24 hours; RSBI (times×min^-1×L^-1): 88.67±4.05 vs. 92.35±4.03 at 12 hours, 77.66±4.64 vs. 90.98±4.21 at 24 hours; total mechanical power (mJ): 10.40±1.15 vs. 12.93±1.68 at 12 hours, 11.13±1.18 vs. 14.05±1.69 at 24 hours; non-dependent zone mechanical power (mJ): 7.15±0.84 vs. 7.98±0.75 at 12 hours, 7.77±0.93 vs. 9.13±1.10 at 24 hours], and MEP and MIP in the ECCO₂R group were significantly higher than those in the conventional treatment group at both 12 hours and 24 hours during the treatment [MEP (cmH₂O, 1 cmH₂O ≈ 0.098 kPa): 89.88±5.04 vs. 86.09±5.57 at 12 hours, 96.57±2.59 vs. 88.66±2.98 at 24 hours; MIP (cmH₂O): 47.64±2.82 vs. 41.93±2.44 at 12 hours, 60.11±6.53 vs. 43.63±2.80 at 24 hours], the differences were statistically significant (all P < 0.05). CONCLUSIONS V-V ECCO₂R combined with non-invasive ventilation can effectively reduce the regional tidal volume, mechanical power, and respiratory rate in the non-gravitational dependent zones of patients with mild to moderate ARDS, and improve respiratory distress and oxygenation status.
Humans ; Respiratory Distress Syndrome/physiopathology* ; Retrospective Studies ; Carbon Dioxide ; Blood Gas Analysis ; Lung/physiopathology* ; Intensive Care Units ; Male ; Female ; Noninvasive Ventilation/methods* ; Continuous Renal Replacement Therapy/methods* ; APACHE ; Middle Aged

Background: Insulinoma is one of the causes of recurrent hypoglycemia, one of the chief complaints for emergency department admission. The gold standard in diagnosing insulinoma is a 72-hour fasting test which is inconvenient and inefficient as it requires hospitalization. Research has found that measurement of insulin and C-peptide during OGTT may help diagnose insulinoma. We aimed to assess the diagnostic value of OGTT in diagnosing insulinoma. Methodology: The literature search was conducted on 19 August 2022 using several databases (MEDLINE, Scopus, Embase, and ScienceDirect). All studies that measured OGTT as diagnostic tools in diagnosing insulinoma and 72-hour fasting test as reference standard were included. The quality assessment of the selected studies was based on the Centre of Evidence-Based Medicine University of Oxford and the Quality Assessment of Diagnostic Accuracy-2 tool (QUADAS-2). Analysis of the included studies was performed qualitatively. This study was registered on PROSPERO (CRD42022360205). Results: A total of two case-control studies (106 patients) were included, which were at risk of bias and low concern of applicability. Both studies demonstrated that the combination of insulin and C-peptide levels measured during OGTT had high specificity, sensitivity, positive predictive value, and negative predictive value in diagnosing insulinoma compared to the reference standard. A logistic regression model of 8.305 – (0.441 × insulin 2-h/0-h) – (1.679 × C-peptide 1-h/0-h) > 0.351 has the highest diagnostic value in one study (AUC 0.97, Sensitivity 86.5%, Specificity 95.2%, PPV 94.1, NPV 88.9). Conclusion The measurement of 0-h and 2-h insulin and C-peptide levels during 2-h OGTT was found in two small case-control studies with a total of 106 patients to have good sensitivity and specificity. However, due to these limitations, future research is still needed to validate the potential use of OGTT for the diagnosis of insulinoma.
Insulinoma ; Glucose Tolerance Test

BACKGROUND

Diabetes Mellitus Type 2 is a significant global health issue with a high prevalence in the Philippines. Managing this condition effectively is crucial, and digital technologies, particularly smartphone (mHealth) applications, have emerged as a potential tool in diabetes self-management.

OBJECTIVE

This study evaluated the effectiveness of smartphone (mHealth) application use in achieving glycemic control among adults with Type 2 Diabetes Mellitus, focusing on HbA1c levels and medication adherence.

METHOD

This systematic review and meta-analysis, adhering to PRISMA guidelines, analyzed randomized controlled trials from databases like PubMed and Embase, comparing interventions using mHealth applications with standard care. The primary measures were HbA1c levels and medication adherence.

RESULTS

Ten studies involving 20,984 participants were included in the meta-analysis. Using mHealth applications led to an average HbA1c reduction of 0.36%, indicating improved glycemic control. There was considerable heterogeneity (I2 = 91%) because of the clinical and methodological diversity of the included studies. Subgroup analysis showed that the younger and older age groups, shorter and longer T2DM duration, and lower and higher HbA1c baseline benefited from its use. Sensitivity analysis still showed high heterogeneity (95%-97%), reflecting clinical diversity. A narrative analysis of two studies highlighted the utility of mHealth applications in tracking diet, physical activity, and vital stats, aiding medication adherence through reminders and data sharing with healthcare providers.

CONCLUSION/RECOMMENDATIONS

This systematic review and meta-analysis showed the effectiveness of mHealth application use in achieving glycemic control among adults with Type 2 Diabetes Mellitus by improving HbA1c levels and medication adherence. Integrating mHealth applications as adjuncts in family and community medicine as part of personalized care for managing type 2 diabetes in the Philippines can help achieve glycemic control and medication adherence. Future studies should focus on longitudinal assessments, exploring cultural and linguistic factors in the Filipino context to optimize diabetes care within this specialized medical framework.

Blood Glucose Self-monitoring ; Mobile Applications ; Diabetes Mellitus