BACKGROUND: The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM. METHODS: A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM. RESULTS: Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses. CONCLUSION The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans ; Female ; Pregnancy ; Diabetes, Gestational/immunology* ; Prospective Studies ; Adult ; Inflammation/immunology* ; Glucose Tolerance Test ; Birth Cohort

Blood biochemical indicators are an important basis for the diagnosis and treatment by doctors. The performance of related instruments, the qualification of operators, the storage method and time of blood samples and other factors will affect the accuracy of test results. However, it is difficult to meet the clinical needs of rapid detection and early screening of diseases with currently available methods. Point-of-care testing (POCT) is a new diagnostic technology with the characteristics of instant, portability, accuracy and efficiency. Microfluidic chips can provide an ideal experimental reaction platform for POCT. This paper summarizes the existing detection methods for common biochemical indicators such as blood glucose, lactic acid, uric acid, dopamine and cholesterol, and focuses on the application status of POCT based on microfluidic technology in blood biochemistry. It also summarizes the advantages and challenges of existing methods and prospects for development. The purpose of this paper is to provide relevant basis for breaking through the technical barriers of microfluidic and POCT product development in China.
Humans ; Point-of-Care Testing ; Lactic Acid/blood* ; Microfluidic Analytical Techniques/methods* ; Blood Glucose/analysis* ; Point-of-Care Systems ; Blood Chemical Analysis/instrumentation* ; Uric Acid/blood* ; Cholesterol/blood* ; Dopamine/blood* ; Microfluidics/methods*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Background: Insulinoma is one of the causes of recurrent hypoglycemia, one of the chief complaints for emergency department admission. The gold standard in diagnosing insulinoma is a 72-hour fasting test which is inconvenient and inefficient as it requires hospitalization. Research has found that measurement of insulin and C-peptide during OGTT may help diagnose insulinoma. We aimed to assess the diagnostic value of OGTT in diagnosing insulinoma. Methodology: The literature search was conducted on 19 August 2022 using several databases (MEDLINE, Scopus, Embase, and ScienceDirect). All studies that measured OGTT as diagnostic tools in diagnosing insulinoma and 72-hour fasting test as reference standard were included. The quality assessment of the selected studies was based on the Centre of Evidence-Based Medicine University of Oxford and the Quality Assessment of Diagnostic Accuracy-2 tool (QUADAS-2). Analysis of the included studies was performed qualitatively. This study was registered on PROSPERO (CRD42022360205). Results: A total of two case-control studies (106 patients) were included, which were at risk of bias and low concern of applicability. Both studies demonstrated that the combination of insulin and C-peptide levels measured during OGTT had high specificity, sensitivity, positive predictive value, and negative predictive value in diagnosing insulinoma compared to the reference standard. A logistic regression model of 8.305 – (0.441 × insulin 2-h/0-h) – (1.679 × C-peptide 1-h/0-h) > 0.351 has the highest diagnostic value in one study (AUC 0.97, Sensitivity 86.5%, Specificity 95.2%, PPV 94.1, NPV 88.9). Conclusion The measurement of 0-h and 2-h insulin and C-peptide levels during 2-h OGTT was found in two small case-control studies with a total of 106 patients to have good sensitivity and specificity. However, due to these limitations, future research is still needed to validate the potential use of OGTT for the diagnosis of insulinoma.
Insulinoma ; Glucose Tolerance Test

BACKGROUND

Diabetes Mellitus Type 2 is a significant global health issue with a high prevalence in the Philippines. Managing this condition effectively is crucial, and digital technologies, particularly smartphone (mHealth) applications, have emerged as a potential tool in diabetes self-management.

This study evaluated the effectiveness of smartphone (mHealth) application use in achieving glycemic control among adults with Type 2 Diabetes Mellitus, focusing on HbA1c levels and medication adherence.

This systematic review and meta-analysis, adhering to PRISMA guidelines, analyzed randomized controlled trials from databases like PubMed and Embase, comparing interventions using mHealth applications with standard care. The primary measures were HbA1c levels and medication adherence.

Ten studies involving 20,984 participants were included in the meta-analysis. Using mHealth applications led to an average HbA1c reduction of 0.36%, indicating improved glycemic control. There was considerable heterogeneity (I2 = 91%) because of the clinical and methodological diversity of the included studies. Subgroup analysis showed that the younger and older age groups, shorter and longer T2DM duration, and lower and higher HbA1c baseline benefited from its use. Sensitivity analysis still showed high heterogeneity (95%-97%), reflecting clinical diversity. A narrative analysis of two studies highlighted the utility of mHealth applications in tracking diet, physical activity, and vital stats, aiding medication adherence through reminders and data sharing with healthcare providers.

This systematic review and meta-analysis showed the effectiveness of mHealth application use in achieving glycemic control among adults with Type 2 Diabetes Mellitus by improving HbA1c levels and medication adherence. Integrating mHealth applications as adjuncts in family and community medicine as part of personalized care for managing type 2 diabetes in the Philippines can help achieve glycemic control and medication adherence. Future studies should focus on longitudinal assessments, exploring cultural and linguistic factors in the Filipino context to optimize diabetes care within this specialized medical framework.

Diabetes and its complications pose a serious threat to human life and health. It has become a public health problem of wide concern worldwide. Currently, diabetes is mainly treated with insulin injection in clinic. However, manual insulin injection still has many shortcomings. In recent years, with the deepening of research, it has been found that an automated insulin delivery system (AID), which combines a continuous glucose monitoring device with an insulin pump, can significantly improve the effectiveness of diabetes treatment and reduce the incidence of complications in patients. This paper firstly introduces the composition of the AID system and its working principle, and then details the development history and current status of the related technologies from the aspects of continuous glucose monitoring technology, insulin pumps and the development of closed-loop control algorithms, etc. Finally, this paper looks forward to the application prospect and future development of AID system in the field of diabetes treatment, providing theoretical reference for further research.
Humans ; Insulin Infusion Systems ; Insulin/administration & dosage* ; Blood Glucose Self-Monitoring/instrumentation* ; Diabetes Mellitus/drug therapy* ; Algorithms ; Hypoglycemic Agents/administration & dosage* ; Blood Glucose/analysis* ; Pancreas, Artificial ; Automation

OBJECTIVE: To explore the effects of veno-venous extra corporeal carbon dioxide removal (V-V ECCO₂R) on local mechanical power and gas distribution in the lungs of patients with mild to moderate acute respiratory distress syndrome (ARDS) receiving non-invasive ventilation. METHODS: Retrospective research methods were conducted. Sixty patients with mild to moderate ARDS complicated with renal insufficiency who were transferred to the respiratory intensive care unit (RICU) through the 96195 platform critical care transport green channel from January 2018 to January 2020 at the collaborative hospitals of Henan Provincial People's Hospital were enrolled. According to different treatment methods, they were divided into a conventional treatment group and an ECCO₂R group, with 30 patients in each group. Both groups received standard treatments including primary disease treatment, airway management, and non-invasive ventilation. The conventional treatment group received bedside continuous renal replacement therapy (CRRT), and the ECCO₂R group received V-V ECCO₂R treatment. General information of patient such as gender, age, cause of disease, and acute physiology and chronic health evaluation II (APACHE II) were recorded; arterial blood gas analysis was performed before treatment and at 12 hours and 24 hours during treatment, recording arterial partial pressure of oxygen (PaO₂), arterial partial pressure of carbon dioxide (PaCO₂), and oxygenation index (PaO₂/FiO₂). Respiratory mechanics parameters [tidal volume, respiratory rate, maximal inspiratory pressure (MIP), and maximal expiratory pressure (MEP)] were recorded, and the rapid shallow breathing index (RSBI) was calculated; electrical impedance tomography (EIT) was used to measure regional of interest (ROI) values in different lung areas at 12 hours and 24 hours of treatment, and the pulmonary mechanical energy was calculated. RESULTS: The arterial blood gas analysis indicators, respiratory mechanics parameters, and pulmonary mechanical energy of patients in the conventional treatment group and ECCO₂R group improved significantly after 24 hours of treatment compared to 12 hours of treatment (all P < 0.05). The levels of PaCO₂, RSBI, total mechanical power, and non-dependent zone mechanical power in the ECCO₂R group were significantly lower than those in the conventional treatment group at both 12 hours and 24 hours during the treatment [PaCO₂ (mmHg, 1 mmHg ≈ 0.133 kPa): 44.03±2.96 vs. 49.96±2.50 at 12 hours, 41.65±3.21 vs. 48.53±2.33 at 24 hours; RSBI (times×min^-1×L^-1): 88.67±4.05 vs. 92.35±4.03 at 12 hours, 77.66±4.64 vs. 90.98±4.21 at 24 hours; total mechanical power (mJ): 10.40±1.15 vs. 12.93±1.68 at 12 hours, 11.13±1.18 vs. 14.05±1.69 at 24 hours; non-dependent zone mechanical power (mJ): 7.15±0.84 vs. 7.98±0.75 at 12 hours, 7.77±0.93 vs. 9.13±1.10 at 24 hours], and MEP and MIP in the ECCO₂R group were significantly higher than those in the conventional treatment group at both 12 hours and 24 hours during the treatment [MEP (cmH₂O, 1 cmH₂O ≈ 0.098 kPa): 89.88±5.04 vs. 86.09±5.57 at 12 hours, 96.57±2.59 vs. 88.66±2.98 at 24 hours; MIP (cmH₂O): 47.64±2.82 vs. 41.93±2.44 at 12 hours, 60.11±6.53 vs. 43.63±2.80 at 24 hours], the differences were statistically significant (all P < 0.05). CONCLUSIONS V-V ECCO₂R combined with non-invasive ventilation can effectively reduce the regional tidal volume, mechanical power, and respiratory rate in the non-gravitational dependent zones of patients with mild to moderate ARDS, and improve respiratory distress and oxygenation status.
Humans ; Respiratory Distress Syndrome/physiopathology* ; Retrospective Studies ; Carbon Dioxide ; Blood Gas Analysis ; Lung/physiopathology* ; Intensive Care Units ; Male ; Female ; Noninvasive Ventilation/methods* ; Continuous Renal Replacement Therapy/methods* ; APACHE ; Middle Aged

BACKGROUND: Alcohol consumption is a prevalent behavior that is bi-directionally related to the risk of type 2 diabetes. However, the effect of daily alcohol consumption on glucose levels in real-world situations in the general population has not been well elucidated. This study aimed to clarify the relationship between alcohol consumption and all-day and time-specific glucose levels among non-diabetic individuals. METHODS: We investigated 913 non-diabetic males and females, aged 40-69 years, during 2018-2020 from four communities across Japan. The daily alcohol consumption was assessed using a self-report questionnaire. All-day and time-specific average glucose levels were estimated from the interstitial glucose concentrations measured using the Flash glucose monitoring system for a median duration of 13 days. Furthermore, we investigated the association between all-day and time-specific average glucose levels and habitual daily alcohol consumption levels, using never drinkers as the reference, and performed multiple linear regression analyses after adjusting for age, community, and other diabetes risk factors for males and females separately. RESULTS: All-day average glucose levels did not vary according to alcohol consumption categories in both males and females. However, for males, the average glucose levels between 5:00 and 11:00 h and between 11:00 and 17:00 h were higher in moderate and heavy drinkers than in never drinkers, with the difference values of 4.6 and 4.7 mg/dL for moderate drinkers, and 5.7 and 6.8 mg/dL for heavy drinkers. Conversely, the average glucose levels between 17:00 and 24:00 h were lower in male moderate and heavy drinkers and female current drinkers than in never drinkers; the difference values of mean glucose levels were -5.8 for moderate drinkers, and -6.1 mg/dL for heavy drinkers in males and -2.7 mg/dL for female current drinkers. CONCLUSIONS Alcohol consumption was associated with glucose levels in a time-dependent biphasic pattern.
Humans ; Male ; Female ; Diabetes Mellitus, Type 2 ; Blood Glucose Self-Monitoring ; Blood Glucose ; Alcohol Drinking/epidemiology* ; Risk Factors ; Alcoholic Intoxication

Most information used to evaluate diabetic statuses is collected at a special time-point, such as taking fasting plasma glucose test and providing a limited view of individual's health and disease risk. As a new parameter for continuously evaluating personal clinical statuses, the newly developed technique "continuous glucose monitoring" (CGM) can characterize glucose dynamics. By calculating the complexity of glucose time series index (CGI) with refined composite multi-scale entropy analysis of the CGM data, the study showed for the first time that the complexity of glucose time series in subjects decreased gradually from normal glucose tolerance to impaired glucose regulation and then to type 2 diabetes (P for trend < 0.01). Furthermore, CGI was significantly associated with various parameters such as insulin sensitivity/secretion (all P < 0.01), and multiple linear stepwise regression showed that the disposition index, which reflects β-cell function after adjusting for insulin sensitivity, was the only independent factor correlated with CGI (P < 0.01). Our findings indicate that the CGI derived from the CGM data may serve as a novel marker to evaluate glucose homeostasis.
Humans ; Glucose ; Blood Glucose ; Insulin Resistance/physiology* ; Diabetes Mellitus, Type 2/diagnosis* ; Blood Glucose Self-Monitoring ; Time Factors ; Insulin

OBJECTIVE: To investigate the mechanism of self-efficacy between self-management ability and self-management behavior and its differences among patients with different disease courses through mediation tests. METHODS: In the study, 489 patients with type 2 diabetes who attended the endocrinology departments of four hospitals in Shanxi Province and Inner Mongolia Autonomous Region from July to September 2022 were enrolled as the study population. They were investigated by General Information Questionnaire, Diabetes Self-Management Scale, Chinese version of Diabetes Empowerment Simplified Scale, and Diabetes Self-Efficacy Scale. Mediation analyses were performed using the linear regression model, Sobel test, and Bootstrap test in the software Stata version 15.0 and divided the patients into different disease course groups for subgroup analysis according to whether the disease course was > 5 years. RESULTS: In this study, the score of self-management behavior in the patients with type 2 diabetes was 6.16±1.41, the score of self-management ability was 3.99±0.74, and the score of self-efficacy was 7.05±1.90. The results of the study showed that self-efficacy was positively correlated with self-management ability (r=0.33) as well as self-management behavior (r=0.47) in the patients with type 2 diabetes (P < 0.01). The mediating effect of self-efficacy accounted for 38.28% of the total effect of self-management ability on self-management behaviors and was higher in the behaviors of blood glucose monitoring (43.45%) and diet control (52.63%). The mediating effect of self-efficacy accounted for approximately 40.99% of the total effect for the patients with disease course ≤ 5 years, while for the patients with disease course > 5 years, the mediating effect accounted for 39.20% of the total effect. CONCLUSION Self-efficacy enhanced the effect of self-management ability on the behavior of the patients with type 2 diabetes, and this positive effect was more significant for the patients with shorter disease course. Targeted health education should be carried out to enhance patients' self-efficacy and self-management ability according to their disease characteristics, to stimulate their inner action, to promote the development of their self-management behaviors, and to form a more stable and long-term mechanism for disease management.
Humans ; Diabetes Mellitus, Type 2/therapy* ; Self Efficacy ; Self-Management ; Blood Glucose Self-Monitoring ; Blood Glucose ; Self Care