1.Quality of care among patients with acute heart failure at the emergency room and adherence of physicians at the University of the Philippines – Philippine General Hospital to the division of cardiovascular medicine – heart failure pathway:A retrospective cohort study.
Mark John D. Sabando ; Felix Eduardo R. Punzalan ; Frances Dominique V. Ho ; Tam Adrian P. Aya-ay ; Kevin Paul Da. Enriquez ; Marie Kirk A. Maramara ; Ronald Allan B. Roderos ; Lauren Kay M. Evangelista
Acta Medica Philippina 2026;60(2):22-32
OBJECTIVES
Clinical pathways (CPs) ensure adherence to heart failure (HF) management guidelines. To optimize quality care in a low resource setting, an evidence-based care pathway for the management of acute HF was implemented at the emergency department (ED) of the Philippine General Hospital (PGH), the designated national tertiary hospital and referral center. This study aimed to describe the characteristics of adults with acute HF admitted at the ED and evaluate the quality of care they received, measured using physician adherence to the hospital’s acute heart failure CP.
METHODSThis was a retrospective, descriptive cohort study. We reviewed the inpatient charts of all adult patients with acute HF admitted to the ED of the PGH and referred to the Division of Cardiovascular Medicine between December 1, 2022 and May 31, 2023. Quality of care was assessed based on adherence to quality indicators adapted from routine and conditional order sets detailed in the pathway. Descriptive statistics was utilized to describe patient characteristics, quality of care, and outcomes.
RESULTSTwo hundred thirty-six (236) patients were included, with a mean age of 51.8 years. Majority were male (53.4%); hypertension (61.4%) and ischemic heart disease (53.8%) were the most common comorbidities, and infection the most common precipitant of decompensation (60.6%). There were optimal adherence rates to routine orders, which included referrals to Internal Medicine and Cardiology, baseline vital signs monitoring, fluid intake and output monitoring, chest radiograph, complete blood count, blood urea nitrogen, sodium, potassium, prothrombin time, partial thromboplastin time, arterial blood gas, urinalysis, and N-terminal pro b-type natriuretic peptide. Conditional orders, such as oxygen support, focused echocardiography, thyroid - stimulating hormone, and the use of vasopressors, diuretics, and venous thromboembolism prophylactic agents, were optimally performed when warranted. However, we noted suboptimal adherence to certain resource-intensive conditional orders, such as hourly monitoring of urine output (61.4%), hooking to cardiac monitor (53.8%), and performance of 12-lead ECG within 10 minutes (56.8%). Further, only 43.9% of patients were referred to the intensive care unit. Troponin I, calcium, magnesium, and albumin were ordered in excess.
CONCLUSIONOverall adherence rate of physicians to the hospital’s Acute Heart Failure Pathway was satisfactory. Work is needed to improve adherence to hourly urine output monitoring, consistent hooking to cardiac monitor, and timely performance of 12-lead ECG – an effort that begins with expanding in-hospital diagnostic equipment and human resource supply. We recommend continuous pathway implementation with periodic evaluation and stakeholder feedback to further improve quality of care.
Human ; Male ; Female ; Middle Aged: 45-64 Yrs Old ; Adult ; Albumins ; Blood ; Blood Urea Nitrogen ; Calcium ; Cardiology ; Chart ; Charts ; Cohort Studies ; Critical Care ; Critical Pathways ; Diagnostic Equipment ; Disease ; Diuretics ; Echocardiography ; Electrocardiography ; Emergencies ; Emergency Service, Hospital ; Equipment And Supplies ; Evaluation Studies As Topic ; Feedback ; Heart ; Heart Diseases ; Heart Failure ; Hormones ; Hospitals ; Hospitals, General ; Humans ; Hypertension ; Indicators And Reagents ; Infection ; Infections ; Inpatients ; Intensive Care Units ; Internal Medicine ; Lead ; Magnesium ; Male ; Medicine ; Myocardial Ischemia ; Natriuretic Peptide, Brain ; Natriuretic Peptides ; Nitrogen ; Overall ; Oxygen ; Partial Thromboplastin Time ; Patients ; Peptides ; Philippines ; Physicians ; Potassium ; Prothrombin ; Prothrombin Time ; Quality Of Health Care ; Referral And Consultation ; Sodium ; Statistics ; Tertiary Care Centers ; Thorax ; Thromboembolism ; Thromboplastin ; Thyroid Gland ; Time ; Troponin ; Troponin I ; Universities ; Urea ; Urinalysis ; Urine ; Venous Thromboembolism ; Vital Signs ; Work ; Workforce
2.Clinical, metabolic, and autoimmune characteristics of newly diagnosed young Filipino adults with diabetes mellitus.
Elizabeth Paz-Pacheco ; Angelique Bea C. Uy ; Angelique Love Tiglao-Gica ; Anna Elvira S. Arcellana ; Aura Bree Dayo-Lacdao ; Cynthia P. Cordero ; Cecilia A. Jimeno ; Ma. Cecille Añ ; onuevo-Cruz ; Noel R. Juban
Acta Medica Philippina 2026;60(2):41-49
OBJECTIVES
In Asia, younger individuals (below age 45) are diagnosed to have type 2 diabetes with increased rates of obesity defined by lower BMI yet with greater visceral adiposity (waist circumference and waisthip ratios). The prevalence data on type 1 diabetes is not well established, considered to be low, but is seen to be increasing as well. This changing phenotype therefore, presents a clinical dilemma in terms of correctly classifying diabetes and deciding on the consequent appropriate treatment. Distinguishing type 1 from type 2 diabetes has become more difficult with type 2 diabetes dramatically increasing in young adults and children. This study aims to define the characteristics of diabetes among young adults in the Philippines to provide a basis for appropriate management amidst changes in diabetes phenotypes seen globally.
METHODSIn this cross-sectional analytic study, we characterized the demographic, metabolic, and autoimmune features of diabetes among young adult Filipinos aged 18 to 45 years old consulting at a tertiary referral center in Manila, Philippines. Baseline serum A1c, FBS, 75-g oral glucose tolerance test, insulin, serum C-peptide, insulin autoantibodies, leptin, adiponectin, lipid profile, and thyroid function tests were obtained from the participants and analyzed. The homeostasis model assessment (HOMA) was used to estimate the insulin sensitivity.
RESULTSA total of 348 patients with diabetes were included, with females comprising two-thirds of the participants. The mean age at diagnosis of diabetes was 35.9±7.22 years. The mean BMI was 28.12 kg/m2, with median waist to hip ratio (WHR) of 0·93. Metabolic syndrome was found in 60% of participants and 67.82% were obese by body mass index. The mean A1c was 9.07±2.52%. Good glucose control (A1c less than 7.0%) was seen in 23% of participants while nearly half (48%) had HbA1c which was >9.0%. The median levels of fasting insulin and C-peptide were 12.62 (range 1.33–90.42) mIU/L and 0.78 ng/mL (range 0–16.2), respectively.
Included participants were diagnosed with diabetes within a year and as such, majority did not have any micro- or macrovascular complications. The most common diabetes complication was sensory neuropathy detected by monofilament testing, which was found in 28% of participants, followed by non-proliferative diabetic retinopathy in 13%. A history of previous diabetic ketoacidosis was found in 10 patients (2.87%). Glutamic acid decarboxylase (GAD) and insulin auto-antibodies were found in 3.2% and 19.3% of participants, respectively. Approximately half (51.73%) of the participants were insulin resistant by HOMA-IR.
CONCLUSIONIn contrast with Caucasians and other Asians, diabetes among young Filipino adults is associated with lower BMI but with a similarly high visceral adiposity as shown by an elevated WHR. Metabolic syndrome with insulin resistance as defined by a variety of indices is predominant. Type 1 diabetes with autoantibodies occur in only a small fraction of this population. Data derived from this work can provide a framework for cluster analysis towards personalized management specific to this population.
Human ; Acids ; Adiponectin ; Adiposity ; Adult ; Aged ; Antibodies ; Asia ; Asian ; Asian Continental Ancestry Group ; Autoantibodies ; Body Mass Index ; C-peptide ; Carboxy-lyases ; Child ; Cluster Analysis ; Demography ; Diabetes Complications ; Diabetes Mellitus ; Diabetes Mellitus, Type 1 ; Diabetes Mellitus, Type 2 ; Diabetic Ketoacidosis ; Diabetic Retinopathy ; Diagnosis ; Fasting ; Female ; Glucose ; Glucose Tolerance Test ; Glutamate Decarboxylase ; Glutamic Acid ; Insulin ; Insulin Resistance ; Ketosis ; Leptin ; Lipids ; Metabolic Syndrome ; Obesity ; Patients ; Peptides ; Phenotype ; Philippines ; Population ; Prevalence ; Serum ; Therapeutics ; Thyroid Gland ; Thyroid Function Tests ; Young Adult
3.One-hour OGTT reveals what conventional screening misses: A hidden prediabetes burden in Malaysia
Gerard Jason Mathews ; Seetha Devi Subramanian ; Nor Shaffinaz Yusoff Azmi Merican ; Shartiyah Ismail ; Joel Mathews ; Leng Ean Charis Kong ; Chong Hui Khaw ; Shubash Shander Ganapathy ; Arvinder-Singh HS
Journal of the ASEAN Federation of Endocrine Societies 2026;41(S1):1-
Introduction:
Prediabetes or intermediate hyperglycemia (IH) represents a critical phase in the trajectory toward type 2 diabetes mellitus
(T2DM). Recent evidence from the International Diabetes Federation (IDF) suggests that 1-hour OGTT (1HOGTT) ≥8.6
mmol/L is a more sensitive biomarker for early beta-cell dysfunction, with enhanced detection of IH and future T2DM
risk. Conventional screening using hemoglobin A1c (HbA1c) or 2-Hour OGTT (2HOGTT) may delay identification
of prediabetes, narrowing the window for early intervention. This study evaluates 1HOGTT as a screening tool for
prediabetes among Malaysians.
Methodology:
This cross-sectional study enrolled adults without prior T2DM or prediabetes. Participants underwent 1HOGTT, 2HOGTT,
and HbA1c, classified as per the Malaysian Clinical Practice Guideline for T2DM (6th Edition) and IDF 2024 criteria.
Agreement between tests was assessed using McNemar’s test and Cohen’s kappa. Diagnostic accuracy was evaluated
via receiver operating characteristic (ROC) curve analysis. Cost-effectiveness was determined using reagent cost only.
Results:
The majority of the 310 participants were female (71.6%), Malay (87.1%), with average age of 40. The 1HOGTT identified
prediabetes in 21.6% (n = 67) compared to 17.1% (n = 53) by HbA1c and 2.6% (n = 8) by 2HOGTT. McNemar’s test confirmed
statistically significant discordance between 1HOGTT and 2HOGTT (chi-square = 53.397, p <0.001): 61 participants were
prediabetic by 1HOGTT but normal by 2HOGTT, versus only 2 in the reverse direction. No significant discordance was
found between 1HOGTT and HbA1c (chi-square = 2.817, p = 0.093). 1HOGTT demonstrated excellent discriminatory
ability against 2HOGTT (AUC = 0.908; 95% CI: 0.837–0.978), significantly outperforming HbA1c (AUC = 0.664; CI: 0.462–
0.867; DeLong p = 0.012). In a population-level cost analysis, 1HOGTT achieved lowest cost per prediabetes case detected
(RM 5.79) – approximately 8.3 times and 8.1 times more cost-effective than 2HOGTT (RM 48.08) and HbA1c (RM 46.78)
respectively.
Conclusion
1HOGTT identifies a significant proportion of individuals with prediabetes missed by 2HOGTT and HbA1c. Incorporating 1HOGTT enhances the detection of prediabetes, is cost-effective, and enables timely preventive measures in our
population with high diabetes burden.
Glucose Tolerance Test
;
Glycated Hemoglobin
;
Prediabetic State
4.Real-World Continuous Glucose Monitoring Patterns in Malaysian Adults With Type 2 Diabetes: A Single-Centre Study
Ryan Jia Xian Koh ; Siti Nabilah Atiqah Othman ; Maszariffah Mashor ; Azni Abdul Latif ; Ooi Chuan Ng
Journal of the ASEAN Federation of Endocrine Societies 2026;41(S1):45-46
Introduction:
Malaysia has one of the highest diabetes prevalence rates
in Asia (1 in 5), with >50% fail to achieve optimal glycemic
control. Continuous glucose monitoring (CGM) provides
detailed insights beyond hemoglobin A1c (HbA1c),
capturing daily glucose fluctuations and variability. Realworld data describing CGM patterns and their clinical
associations in Malaysian adults with type 2 diabetes
mellitus (T2DM) are limited.
Methodology:
This cross-sectional study analyzed CGM data from 25
Malaysian adults with T2DM, standardized over 14 days.
CGM metrics included time in range (TIR), time above
range (TAR), time below range (TBR), mean glucose,
and coefficient of variation (CV). Weekday–weekend
comparisons were performed, and correlations with
age, diabetes duration, HbA1c, body mass index (BMI),
treatment regimen, and complications were assessed.
Results:
Participants had a mean age of 56.2 ± 13.2 years (52%
male), mean HbA1c 9.4 ± 2.7%, diabetes duration 10.7 ±
9.0 years, and BMI 29.8 ± 9.4 kg/m². Mean TIR, TAR, TBR,
mean glucose, and CV were similar between weekdays
and weekends (p >0.34 for all). TIR >70% was achieved by
52% of participants on weekdays and 48% on weekends,
with no statistically significant difference (p = 0.75). Longer
diabetes duration correlated with lower TIR (r = −0.62, p <0.001), higher mean glucose (r = 0.58, p = 0.002), and greater
variability (r = 0.54, p = 0.004). Older age was associated with
lower TIR (r = −0.48, p = 0.014) and higher mean glucose (r
= 0.44, p = 0.025). Higher HbA1c correlated with lower TIR
(r = −0.36, p = 0.04), higher TAR (r = 0.35, p = 0.05), greater
variability (r = 0.51, p = 0.006), and increased target organ
damage (ρ = 0.55, p = 0.004). BMI was not associated with
TIR (r = −0.18, p = 0.38). Participants with ≥2 complications
had lower TIR (55.8 ± 28.4% vs 76.7 ± 19.2%, p = 0.073), while
insulin the
Conclusion
In Malaysian adults with T2DM, CGM metrics were similar
between weekdays and weekends, indicating lifestyle
differences had minimal impact on glycemic control. Longer
diabetes duration, older age, higher HbA1c, multiple
complications, and insulin therapy identified patients at
highest risk for poor glycemic control, greater variability,
and hypoglycemia. These findings support the use of
CGM for risk stratification, individualized monitoring,
and therapy optimization to reduce complications and
hypoglycemia risk.
Adult
;
Blood Glucose
;
Blood Glucose Self-Monitoring
;
Continuous Glucose Monitoring
;
Diabetes Mellitus, Type 2
5.Diagnostic Dilemma in Interpreting Inferior Petrosal Sinus Sampling in Suspected Cyclical Cushing’s Disease in an Adolescent
Nicholas Wee Wern Phan ; Pei Sun Tan ; Subashini Rajoo ; Vanusha A/P Devaraja Pillai ; Shazatul Reza binti Mohd Redzuan ; Gayathri Devi Krishnan ; Sharifah Noor Adrilla Long Mohd Noor Affendi
Journal of the ASEAN Federation of Endocrine Societies 2026;41(S1):90-
Introduction:
Cushing’s disease in adolescents is rare and frequently
difficult to diagnose due to overlapping features with
common pubertal and metabolic conditions. We present
an adolescent who underwent inferior petrosal sinus
sampling (IPSS) with possible cyclical Cushing’s disease,
highlighting the diagnostic challenges and the interpretive
value of IPSS.
Case:
A 16-year-old female presented with progressive weight
gain, acne, hirsutism, secondary amenorrhea, proximal
myopathy, violaceous striae, and facial plethora over 1 year.
Her 24-hour urinary cortisol was >3,310 nmol/L with failure
of suppression following a 1-mg overnight dexamethasone
suppression test (701 nmol/L). Her adrenocorticotropic
hormone (ACTH) was raised (77.9 pg/mL), consistent with
ACTH-dependent Cushing syndrome. Her hemoglobin
A1c was 5.9%, and she has low bone mass for age with a
Z score of -2.9 at the Lumbar spine.
Pituitary magnetic resonance imaging identified a rightsided microadenoma measuring 0.6 × 0.5 cm, while
computed tomography of the thorax, abdomen, and
pelvis showed no ectopic source. IPSS with desmopressin
stimulation was performed to confirm the ACTH source.
No steroidogenesis inhibitors were administered prior to
testing. Notably, cortisol levels during IPSS were relatively
low, with midnight cortisol of 91 nmol/L and morning
cortisol of 200 nmol/L, suggesting testing during a trough
phase of possible cyclical hypercortisolism. Despite this,
IPSS demonstrated a significant central-to-peripheral
ACTH gradient supporting a pituitary source.
Conclusion
This case highlights the diagnostic dilemma of interpreting
IPSS in suspected cyclical Cushing’s disease. Fluctuating
cortisol secretion may result in discordant biochemical
findings and complicate localization studies. IPSS findings should be interpreted cautiously and integrated with
clinical features, imaging, and serial biochemical monitoring. Recognition of cyclical disease patterns is essential to
ensure appropriate management in adolescent patients.
Adolescent
;
Humans
;
Petrosal Sinus Sampling
6.Bridging the Gap: Adoption and Barriers to Continuous Glucose Monitoring in Paediatric Type 1 Diabetes
Sok Bee Lim ; Siti Sarah Ahmad Dardiri ; Nalini M. Selveindran ; Arini Nuran Md Idris ; Janet Yeow Hua Hong
Journal of the ASEAN Federation of Endocrine Societies 2026;41(S1):123-
Introduction:
ISPAD guidelines recommend continuous glucose monitoring (CGM) as the standard of care for paediatric type 1 diabetes
(T1DM). However, a “real-world” adoption gap persists, particularly in resource-limited settings. The Introductions of
the study were to evaluate CGM adoption prevalence, identify documented barriers, and compare glycemic outcomes
between active and non-active users.
Methodology:
This retrospective review analyzed electronic medical records (EMR) of 125 paediatric T1DM patients at Hospital Putrajaya
(2025). Data included CGM status, insulin delivery method, and documented barriers. Independent T-tests compared
mean hemoglobin A1c (HbA1c) between groups, and multivariable logistic regression identified independent predictors
of adoption.
Results:
Cohort mean age was 11.8 ± 3.8 years. Active CGM users were 32.8% (n = 41), of whom 29.3% (n = 12) utilized predominantly
automated insulin delivery (AID) systems. The remaining 67.2% (n = 84) were classified as non-active users, comprising
both never-users and ex-users (discontinued use). Active users achieved significantly lower mean HbA1c than non-active
users (8.73% vs 9.86%; p <0.001), with no significant difference in rates of DKA (p = 0.564) or severe hypoglycemia (p =
0.250). Among never-users, 42.9% lacked documented technology counselling (p = 0.001). Multivariable analysis identified
funding source as the sole independent predictor of CGM adoption (adjusted OR = 7.76, p <0.001). While the primary
documented barrier was financial (31.0%), a lack of documented barriers was noted in 61.9% of non-active users.
Conclusion
A substantial technology gap exists, primarily driven by financial access rather than clinical demographics. The difference
of 1.13% in HbA1c between groups underscores the need to address financial setbacks to improve technology access in
Malaysia and prevent diabetes complications.
Child
;
Blood Glucose
;
Blood Glucose Self-Monitoring
;
Continuous Glucose Monitoring
;
Diabetes Mellitus, Type 1
7.Research progress on point-of-care testing of blood biochemical indexes based on microfluidic technology.
Huaqing ZHANG ; Canjie HU ; Pengjia QI ; Zhanlu YU ; Wei CHEN ; Jijun TONG
Journal of Biomedical Engineering 2025;42(1):205-211
Blood biochemical indicators are an important basis for the diagnosis and treatment by doctors. The performance of related instruments, the qualification of operators, the storage method and time of blood samples and other factors will affect the accuracy of test results. However, it is difficult to meet the clinical needs of rapid detection and early screening of diseases with currently available methods. Point-of-care testing (POCT) is a new diagnostic technology with the characteristics of instant, portability, accuracy and efficiency. Microfluidic chips can provide an ideal experimental reaction platform for POCT. This paper summarizes the existing detection methods for common biochemical indicators such as blood glucose, lactic acid, uric acid, dopamine and cholesterol, and focuses on the application status of POCT based on microfluidic technology in blood biochemistry. It also summarizes the advantages and challenges of existing methods and prospects for development. The purpose of this paper is to provide relevant basis for breaking through the technical barriers of microfluidic and POCT product development in China.
Humans
;
Point-of-Care Testing
;
Lactic Acid/blood*
;
Microfluidic Analytical Techniques/methods*
;
Blood Glucose/analysis*
;
Point-of-Care Systems
;
Blood Chemical Analysis/instrumentation*
;
Uric Acid/blood*
;
Cholesterol/blood*
;
Dopamine/blood*
;
Microfluidics/methods*
8.Associations of systemic immune-inflammation index and systemic inflammation response index with maternal gestational diabetes mellitus: Evidence from a prospective birth cohort study.
Shuanghua XIE ; Enjie ZHANG ; Shen GAO ; Shaofei SU ; Jianhui LIU ; Yue ZHANG ; Yingyi LUAN ; Kaikun HUANG ; Minhui HU ; Xueran WANG ; Hao XING ; Ruixia LIU ; Wentao YUE ; Chenghong YIN
Chinese Medical Journal 2025;138(6):729-737
BACKGROUND:
The role of inflammation in the development of gestational diabetes mellitus (GDM) has recently become a focus of research. The systemic immune-inflammation index (SII) and systemic inflammation response index (SIRI), novel indices, reflect the body's chronic immune-inflammatory state. This study aimed to investigate the associations between the SII or SIRI and GDM.
METHODS:
A prospective birth cohort study was conducted at Beijing Obstetrics and Gynecology Hospital from February 2018 to December 2020, recruiting participants in their first trimester of pregnancy. Baseline SII and SIRI values were derived from routine clinical blood results, calculated as follows: SII = neutrophil (Neut) count × platelet (PLT) count/lymphocyte (Lymph) count, SIRI = Neut count × monocyte (Mono) count/Lymph count, with participants being grouped by quartiles of their SII or SIRI values. Participants were followed up for GDM with a 75-g, 2-h oral glucose tolerance test (OGTT) at 24-28 weeks of gestation using the glucose thresholds of the International Association of Diabetes and Pregnancy Study Groups (IADPSG). Logistic regression was used to analyze the odds ratios (ORs) (95% confidence intervals [CIs]) for the the associations between SII, SIRI, and the risk of GDM.
RESULTS:
Among the 28,124 women included in the study, the average age was 31.8 ± 3.8 years, and 15.76% (4432/28,124) developed GDM. Higher SII and SIRI quartiles were correlated with increased GDM rates, with rates ranging from 12.26% (862/7031) in the lowest quartile to 20.10% (1413/7031) in the highest quartile for the SII ( Ptrend <0.001) and 11.92-19.31% for the SIRI ( Ptrend <0.001). The ORs (95% CIs) of the second, third, and fourth SII quartiles were 1.09 (0.98-1.21), 1.21 (1.09-1.34), and 1.39 (1.26-1.54), respectively. The SIRI findings paralleled the SII outcomes. For the second through fourth quartiles, the ORs (95% CIs) were 1.24 (1.12-1.38), 1.41 (1.27-1.57), and 1.64 (1.48-1.82), respectively. These associations were maintained in subgroup and sensitivity analyses.
CONCLUSION
The SII and SIRI are potential independent risk factors contributing to the onset of GDM.
Humans
;
Female
;
Pregnancy
;
Diabetes, Gestational/immunology*
;
Prospective Studies
;
Adult
;
Inflammation/immunology*
;
Glucose Tolerance Test
;
Birth Cohort
9.Evaluating serum endosialin (CD248) levels as a diagnostic marker in gestational diabetes.
Tevfik Berk BILDACI ; Can ATA ; Ufuk ATLIHAN ; Huseyin Aytug AVSAR ; Selcuk ERKILINC
Journal of the ASEAN Federation of Endocrine Societies 2025;40(2):65-68
OBJECTIVES
Gestational diabetes mellitus (GDM), a pregnancy-induced hyperglycemia, affects approximately 17% of pregnancies globally. Its pathophysiology remains unclear, with inflammation and vascular remodeling playing key roles. CD248, a glycoprotein linked to inflammation and vascular remodeling, has been implicated in various conditions, but its role in GDM is uncertain.
METHODOLOGYA prospective case-control study was conducted with 169 pregnant women aged 18 to 49 at a tertiary hospital. Serum CD248 levels were assessed at 24 to 28 weeks of gestation prior to the oral glucose tolerance test (OGTT). Statistical analyses evaluated the association between CD248 levels, BMI and GDM status.
RESULTSOf the participants, 32 (18.9%) were diagnosed with GDM. CD248 levels were lower in GDM patients (8.15 ± 10.16 ng/mL) than in controls (11.42 ± 15.44 ng/mL), but the difference was not statistically significant (p = 0.084). Although CD248 levels did not correlate with OGTT values, it was positively associated with BMI (pCONCLUSION
Unlike earlier findings associating elevated CD248 levels with early pregnancy GDM risk, this study found no significant relationship during later gestational stages. These results highlight a potentially complex and context-dependent role for CD248 in GDM pathophysiology.
Human ; Diabetes, Gestational ; Inflammation ; Glucose Tolerance Test
10.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test


Result Analysis
Print
Save
E-mail