OBJECTIVETo evaluate the affection of crushing technology on quality. The dissolution of Pills of Six Herbs with Rehmunnia prepared by different crushing technology was determined by taking the dissolution of Paeonol as test marker.

METHODThe Pills was prepared with the fine powder which was crushed by normal crusher or super fine crusher. The rotatory-basket method was used, and the cumulative dissolution percentage was determined by UV.

RESULTStatistics indicated there was a significant difference in dissolution parameter (T50) between super fine crushing powder Pills and normal fine-crushing powder Pills (P < 0.01), and there was a difference in dissolution of different batches of Pills of Six Herbs with Rehmunnia prepared by the normal crush technique (P < 0.05).

CONCLUSIONThe determination of dissolution of Pills of Six Herbs with Rehmunnia is necessary. In order to improve the quality of drugs, we should adopt the technique of super fine crushing in the preparation procedure.

Acetophenones ; analysis ; chemistry ; Drug Combinations ; Drugs, Chinese Herbal ; administration & dosage ; isolation & purification ; Particle Size ; Plants, Medicinal ; chemistry ; Quality Control ; Rehmannia ; chemistry ; Solubility ; Technology, Pharmaceutical ; methods

Diabetic nephropathy is one of the main causes of renal end-stage disease. The pathogenesis of diabetic nephropathy is complex. The current treatment is only for a particular cause without multi-target therapeutic drugs. Chinese medicine is a great treasure with multi-component complex drugs interacting with multiple targets and functions. This paper reviewed the protective effect of Chinese medicine for treating diabetic nephropathy in clinical studies, in vivo studies, and in vitro studies. The possible mechanisms, the major compounds and active crude drugs were also summarized. It was shown that Chinese medicine could not only relieve several symptoms and improve the quality of life, but also reduce the levels of proteinuria and kidney damage, and further improve renal function via multiple pathways based on the whole human system. Moreover, there were no reports of severe adverse reactions during the treatment.
Animals ; Diabetic Nephropathies ; drug therapy ; Drugs, Chinese Herbal ; therapeutic use ; Humans

OBJECTIVETo examine the effect of trastuzumab on cell proliferation, colony formation and changes of HER-2 proteins in human breast cancer cell line SKBR3 and human ovarian cancer cell line SKOV3 cells which overexpress p185 HER-2 but shed high or low HER-2 extracellular domain (ECD) levels.

METHODSSKBR3 cells and SKOV3 cells were treated with or without trastuzumab. Cell number and the rate of colony formation were calculated. Western blot analysis was used to detect p185 HER-2, HER-2 ECD and phospho-HER-2. Two-site ELISA assay was used for the detection of HER-2 ECD.

RESULTSTrastuzumab inhibited cell proliferation, colony formation, and decreased or eliminated the levels of two uncharacterized phospho-proteins (molar weight about 90 000 and 40 000) in SKBR3 cells shedding high level of HER-2 ECD expression. These responses were not observed in SKOV3 cells shedding low level of HER-2 ECD expression. But total p185, phospho-p185 and phospho-p95 proteins did not appear to change in SKBR3 and SKOV3 cells after treatment with trastuzumab. Trastuzumab reacts not only with proteolytic cleavage HER-2 ECD containing HER-2 ECD I , II , III and IV subdomains of p185 HER-2 extracellular domain, but also with the secreted autoinhibitor p68/ECD III a specifying 340 residues, identical to subdomains I and II from the extracellular domain of p185 HER-2, followed by a unique C-terminal sequence of 79 aa encoded by intron 8, which suggested that there may be a trastuzumab binding site on p68/ECD III a protein. Comparing with HER-2 ECD levels of the same number of SKBR3 cells, there was no significant decrease of HER-2 ECD shedding level after treatment with or without trastuzumab for 4 days in serum-free medium.

CONCLUSIONAntitumor effects of trastuzumab may be related to the two uncharacterized phospho-p90 and/or phospho-p40 proteins. There is probably a trastuzumab epitope on p68/ECD III a. The decrease of HER-2 ECD levels may be positively correlated with the number of SKBR3 cells.

Antibodies, Monoclonal ; pharmacology ; Antibodies, Monoclonal, Humanized ; Antineoplastic Agents ; pharmacology ; Blotting, Western ; Breast Neoplasms ; metabolism ; pathology ; Cell Line, Tumor ; Cell Proliferation ; drug effects ; Enzyme-Linked Immunosorbent Assay ; Female ; Humans ; Ovarian Neoplasms ; metabolism ; pathology ; Phosphorylation ; Receptor, ErbB-2 ; metabolism ; Trastuzumab

OBJECTIVEMolecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.

METHODSSeven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.

RESULTSThe FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.

CONCLUSIONA novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.

Alleles ; Asian Continental Ancestry Group ; genetics ; Base Sequence ; Ethnic Groups ; genetics ; Fucosyltransferases ; genetics ; Genotype ; Humans ; Pedigree ; Phenotype ; Polymerase Chain Reaction ; Sequence Analysis, DNA ; Serologic Tests

Diagnostic Errors ; Female ; Humans ; Hymen ; abnormalities ; Infant, Newborn

Objective The present study was conducted to investigate the infection of Lyme disease, Spotted fever, Ehrlichiosis (anaplasmosisin) in wild animals and ticks in the mountain areas of Zhejiang province. Methods Nested polymerase chain reaction was used to amplify specific DNA sequences of Lyme spirochetes, Spotted fever group rickettsiae, Ehrlichia (anaplasma) from samples of mice and ticks. Results 14 positive samples were identified from 121 mice and 105 groups of ticks. Among mice samples, one positive 5S-23S rDNA intergenic spacer of Borreia burgdorferi and two 5' fragments of Ehrlichia (anaplasma) 16S rDNA were obtained. 11 positive results were detected from tick samples including three 5S-23S rDNA intergenic spacer regions of Borreia burgdorferi and eight 5' fragments of Spotted fever group rickettsiae outer member protein A gene. One group of adult ticks, Haemaphysalis longicornis, which had been collected from eastern mountain area were detected to have co-infected with Lyme spirochetes and Spotted fever group rickettsiae. The positive sequences of 5S-23S rDNA intergenic spacer and ompA gene were tested and analyzed as Lyme spirochetes while rickettsia which was closely related to Borrelia valaisiana and R. massilliae. Conclusion This was the first report about co-infection of Lyme spirochetes and Spotted fever group rickettsiae found in the same group of adult Haemaphysalis longicornis. It is very important to strengthen the surveillance program on tick-borne infectious disease and their pathogenic in vectors, wild animals and targeted high risk groups and to differentiate the clinical manifestation and diagnosis to extend the knowledge of tick-borne infectious diseases in Zhejiang.

Carbon nanosheets load beta-cyclodextrin (β-CD-CNS) as a new modified electrode materials was reported for the electrochemical determination of sulfadiazine(SD). Carbon nanosheets(CNS) were prepared by a new method of ultrasonic electrolysis in which the β-CD was attached on CNS through ultrasonic dispersion method. The β-CD-CNS composite nanomaterials were immobilized onto glassy carbon electrodes with drops of coating method to construct an SD voltammetric sensor. The differential pulse stripping voltammetry (DPSV) was used to characterize the electrocatalytic behavior of the developed sensor. The Effects of some parameters on the response behavior of the sensor such as pH,modification amount,scanning rate,stirring speed,stirring time,deposition potential and time were investigated and optimized. The results indicated that the β-CD-CNS composite nanomaterials had excellent electroactivity for the SD in neutral solution and greatly improved the current response of SD. Under the optimal conditions, the SD had an irreversible characteristic oxidation peak around+0.87 V,and the oxidation peak current ip(μA) had a good linear relationship with the concentration C ( μmol/L) of the SD in concentration range of 0.05 μmol/L-13.5 μmol/L with correlation coefficients of 0.999. The detection limit was 12.2 nmol/L (S/N=3). The sensor was successfully applied for the trace SD determination in water and milk samples and the recoveries from the spiked samples were 80.0%-102% with RSD≤5.2%.

OBJECTIVETo establish a method for detecting the polymorphism of methylenetetrahydrofolate reductase gene (MTHFR).

METHODSThe MTHFR was amplified, and the amplified products were detected by denaturing high performance liquid chromatography (DHPLC), and the amplified MTHFR was confirmed by sequencing and restriction enzyme digesting.

RESULTSA total of 334 individuals of Han people in southern China were recruited in our study, and their polymorphisms of MTHFR were detected. The accurate rate of the DHPLC method, that was very sensitive with 100% detection rate available, was over 99%. The frequencies of CC, CT and TT genotypes were 56.9%, 38.3% and 4.8% individually, and the frequencies of T and C alleles were 23.95% and 76.05% individually.

CONCLUSIONThe DHPLC method can detect polymorphism of MTHFR rapidly, effectively and economically. And there is the existence of different MTHFR polymorphisms in area and race.

Adult ; Aged ; Aged, 80 and over ; Alleles ; China ; ethnology ; Chromatography, High Pressure Liquid ; methods ; DNA Mutational Analysis ; Female ; Humans ; Male ; Methylenetetrahydrofolate Dehydrogenase (NAD+) ; genetics ; Methylenetetrahydrofolate Reductase (NADPH2) ; genetics ; Middle Aged ; Nucleic Acid Amplification Techniques ; Polymorphism, Genetic

OBJECTIVE: To study the molecular genetic background of Diego blood group in Chinese Han population. METHODS: A total of 2990 blood samples from unrelated blood donors were phenotyped for Dia and Dib by serological method. Twenty randomly selected samples of Di(a-b+) type and all of the samples of rare Di(a+b-) phenotype by screening were genotyped by PCR-SSP and direct DNA Sequencing. RESULTS: Of the 2990 samples identified by serological method, 2821 were Di(a-b+), 167 were Di(a+b+) and 2 were Di(a+b-). All of the 20 randomly-selected samples with Di(a-b+) phenotype were DI2DI2 homozygote by PCR-SSP genotyping, with nucleotide C at nt position 2561 in exon 19 by direct sequencing of the DI gene. The 2 samples of rare Di (a+b-) phenotype were both the DI1DI1 homozygote, with nucleotide T at nt position 2561 in exon 19. CONCLUSION Our results indicate that the expression of Dia and Dib antigens in Chinese Han population most likely result from a single nucleotide T to C substitution at nucleotide position 2561 in exon 19 of the DI gene, which subsequently leads to an amino acid 854 change from Pro to Leu.
Asian People/genetics* ; Base Sequence ; Blood Donors ; Blood Group Antigens/metabolism* ; Blood Grouping and Crossmatching/methods* ; China/ethnology* ; Exons/genetics* ; Genotype ; Humans ; Molecular Sequence Data ; Phenotype ; Polymerase Chain Reaction/methods* ; Sequence Analysis, DNA

OBJECTIVETo investigate the effects of top pruning on fruiting characters of Platycodon grandiflorum, and find the suitable stage, in which seed growth and development furtherly.

METHODOne-year old seedlings were chosen and planted in field. Plant height, branching number, fruit number per plant, 1000 grains weight were measured during growth and development period, respectively.

RESULTThe treatment of top pruning postponed in turn the flowering date, lowered the plant heights and the fruit number per plant, increased the branching number and influenced significantly on 1000 grains weights.

CONCLUSIONThe suitable stage of top pruning for producing seeds was from June 20th to July 5th.

Crops, Agricultural ; growth & development ; Fruit ; growth & development ; Platycodon ; growth & development