Objective To evaluate the clinical efficacy of AF (atlas fixator) internal fixation in treatment of thoracolumbar fracture and dislocation. Methods 42 cases of thoracolumbar fracture were treated by posterior AF internal fixation. Prior to surgery, anteroposterior and lateral radiographs, and CT scan through bone windows were done for all the patients. During surgery, all the pedicle screws were inserted by Mergerls method and proper insertion was confirmed by radiographs. Results The follow ups of 39 patients averaged 21 months (ranging from 6 to 29 months). After surgery, the correction of anterior vertebral body height averaged 40.2%, and of Cobbs angle 23.2?. 12 cases of incomplete spinal cord injury had significant improvement and 2 ones of complete spinal cord injury had no improvement. Conclusion The AF screw is especially helpful in reconstruction of stability of thoracolumbar region after posterior decompression and reduction, because it results in simplicity, safety, less fixation segments, and little invasion or bleeding.

Alcohol-infusion. Conclusion: With the cell-wall-broken extraction process, a higher content of total flavones was obtained from Pollen Typhae .

Animals ; Ascites ; metabolism ; pathology ; Carcinoma, Hepatocellular ; metabolism ; pathology ; Cell Line, Tumor ; Liver Neoplasms ; metabolism ; pathology ; Lymphatic Metastasis ; Male ; Mice ; Mice, Inbred Strains ; Neoplasm Transplantation ; Ubiquitin Thiolesterase ; metabolism

Objective To explore the effectiveness of sandplay therapy combined with family counseling in children with school phobia and its influence of child′ self-consciousness. Methods Integrative sandplay therary with family consulting were used to treat 28 patients with school phobia regularly for 2 months. Sandplay and family consulting therapy were given once a week for 45 minutes . Clinical outcomes were assessed using CGI-GI and Piers-Harris children′s self-consciousness scale before and after treatment as well as 3 months posttreatment. Results Overall response rate was 85%. In addition, the physical appearance and characteristic factor before and after treatment were no significant difference (P>0.05). The rest of the various factors and total score compared with pre-treatment significantly improved (P<0.05). After treatment for 3 months, every factor in self-consciousness of children and total score were no significant difference (P>0.05). Conclusion Integrative sandplay therapy with family counseling has better and long-lasting treatment effect to self-consciousness of children with school refusal.

Objective To investigate the efficacy of integrated traditional Chinese medicine (TCM) with Western medicine in treatment of diarrhea type irritable bowel syndrome (IBS-D) and its effect on serum inflammatory cytokine levels.Methods One hundred and sixty four IBS-D patients treated in Guangfu Hospital from July 2013 to August 2015 were randomly divided into study group and control group with 82 cases in each group.All patients received oral Saccharomyces boulardii 1.0 b.i.d, while patients in study group received additional Shuganjianpi decoction b.i.d for 4 weeks.The clinical efficacy was observed, serum IL-10, IFN-γ and TNF-α levels were measured in 2 groups.Results After treatment, the total score of clinical symptoms in study group was lower than that of control group [(5.71±1.41) vs.(11.70±2.88) points,t=16.707, P<0.01].Serum levels of IFN-γ, TNF-α in study group decreased significantly after treatment [IFN-γ (2.88±1.38) ng/L vs.(1.00±0.44) ng/L, t=11.609, P<0.01;TNF-α (41.26±5.29) ng/L vs.(24.13±3.27) ng/L,t=24.636, P<0.01], IL-10 significantly increased [(142.23±21.58) ng/L vs.(170.23±33.45) ng/L,t=6.291,P<0.01].The overall effective rate of study group was higher than that of control group, [87.50% (70/80) vs.68.75% (55/80), x2=8.228, P<0.01].After treatment, the quality of life scores in both groups were improved;but the improvement of diet, spirit, mood and sleep scores in study group were better than those in control group [(240±69) vs.(193±60), t=4.579, (316±74) vs.(230 ± 69), t=7.603, (297±62) vs.(228±59), t=7.211;(284±62) vs.(230±54), t=5.874, all P<0.01].Conclusion The efficacy of integrated traditional Chinese medicine with Western medicine in treatment of IBS-D is significantly better than that of Western medicine alone, which may be associated with its regulatory effect on the serum inflammatory cytokine levels.

AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.

Objective:To observe the clinical effect of tuina plus foot bath with Chinese medicine for patients with diabetic foot (DF) in early stage.Methods:A total of 70 patients with early-stage DF were randomly allocated by the random number table into two groups,with 35 cases in each group.Patients in the control group received conventional medication,while patients in the observation group received tuina plus foot bath with Chinese medicine on the basis of conventional medication.The clinical efficacy was compared after 2 courses of treatment.Results:After treatment,intra-group comparisons of ankle-brachial index (ABI) showed statistical significance in both groups (both P＜0.05).The curative rate was 83.3％ in the observation group,with the total effective rate of 96.7％,versus 29.4％ and 76.5％ in the control group,respectively,and the between-group comparisons showed statistical significance (both P＜0.05),indicating a better effect in the observation group.Conclusion:Tuina plus foot bath with Chinese medicine has a good therapeutic effect for DF patients in early stage.

The present study was aimed to investigate the effect of electroacupuncture (EA) on learning-memory of rats with low estrogen-induced cognitive impairment and the possible mechanism. The rat model was established by ovariectomy, which resulted in low estrogen-induced cognitive impairment. EA was applied continuously for 3 months 2 weeks after ovariectomy. Morris water maze was used to test the ability of spatial learning and memory. Enzyme-linked immunosorbent assay (ELISA) and real-time quantitative RT-PCR were used to detect the concentration of serum estradiol (E2) and relative expression of choline acetyltransferase (ChAT) mRNA in hippocampus, respectively. The result showed that, compared with the sham group, the ovariectomy model group exhibited longer escape latency, reduced number of platform-crossing, lower concentration of serum E2, and decreased expression of ChAT mRNA in hippocampus. EA shortened the escape latency and increased the number of platform-crossing in the ovariectomy model group. Moreover, the concentration of serum E2 and the hippocampal expression of ChAT mRNA in the ovariectomy model group were significantly elevated by EA treatment. These results suggest EA is capable of improving learning and memory in ovariectomized rats, and the mechanism involves the up-regulation of the expression of ChAT mRNA in hippocampus induced by the increase of the serum concentration of estrogen.
Animals ; Choline O-Acetyltransferase ; metabolism ; Cognition Disorders ; therapy ; Electroacupuncture ; Estradiol ; blood ; deficiency ; Female ; Hippocampus ; enzymology ; Learning ; Memory ; Ovariectomy ; RNA, Messenger ; Rats

Objective To investigate the variation of procalcitonin(PCT)level and the significance of PCT for the diagnosis of infection during perioperative period of valve replacement for rheumatic heart disease.Methods Routine blood testing and procalcitonin(PCT)level were measured in the perioperative period of 56 patients with rheumatic heart disease receiving valve replacement.Prophylactic antibiotics management was given based on the serum procalcitonin level especialy that 3 days after operation or later.The postoperative infective complications and the duration of prophylactic antibiotics management were recorded and assessed.Results The duration of prophylactic antibiotics for all patients were 4.6 ± 2.0 days.Six patients were suffered from poor incision healing and one was suffered from pulmonary infection.There were no severe postoperative infective complications.The PCT of the patients without postoperative infection rise to peak level on the 1st day after operation and return to normal on the 3rd day.There was no significant difference in the PCT levels between the two groups.The duration for PCT descending to 0.25 mg/L was 3.7 ± 2.5 days.The PCT level of the patients suffered from pulmonary infection went up again after infection on the 5th day and return to normal on the 9th day.No severe postoperative infective complications happened after withdrawn of prophylactic antibiotics if PCT had descended tobelow 0.25 mg/L after operation.Conclusions The serum PCT level may be a good parameter for the prediction or diagnosis of infective complication in the perioperative period of patients undergoing valve replacement for rheumatic heart disease.It can be a useful marker to guide the use of prophylactic antibiotics.

Objective To study the etiological factors,clinical characteristics and diagnosis of acute pancreatitis (AP).Methods The clinical data of 217 patients with AP treated from January 2005to December 2010 in our hospital were studied retrospectively.Results The majority of patients were male (60.4％).The average age was 52.5 years.Cholelithiasiss,hyperlipidemia and trauma were the most frequent etiologic causes of AP.There were 164 patients with mild (75.6％) and 53 patients with severe (24.4％) AP.151 patients underwent surgical or endoscopical treatment (69.6 ％) while 66 patients underwent non-operative treatment (30.4 ％).14 of 53 patients with severe AP died.Conclusions AP should be treated according to the cause and the type.The key to reduce complications and increase cure rate is to find the cause of AP and then treat the underlying disease.