In recent years,the incidence of Tourette syndrome (TS) has been increasing,but the pathogenesis of TS was unclear.Immune abnormalities were reported in some children with TS,who had abnormal levels of helper T cell subgroup Th1/Th2,cytokines,natural killer cells and autoantibodies expression.Balance and moderation of the immune play an important role in maintaining the physiological functioning normally.To study the status of immune in children with TS is conducive to manage strategies of treatment.

Objective To provide reference for improving the performance of public health by establishing performance evaluation framework of public health in rural areas of China.Methods The performance evaluation framework of public health in rural areas is established by literature research,theoretical derivation and Delphi method.The results of expert consultation are tested by W test of Kendall coordination coefficient and chi-square test.Results The performance evaluation framework of public health in rural areas contains four conceptual modules,ten performance goals and twenty-eight performance evaluation indexes.The positive coefficient of experts is 0.889.The average values of authoritative grade of experts are between 0.681～0.715.The Kendall W uniformity coefficients of the necessity,sensitivity and maneuverability of the indexes are respectively 0.167,0.209 and 0.185.The P values are less than 0.01.Conclusion The performance evaluation framework of public health in rural areas has certain application value.It is necessary to pay attention to scientific nature and applicability in developing performance evaluation of public health in rural areas.

Objective To give an empirical study on the interests claims of patients in public hospitals. Methods By questionnaire investigation, to sum up data using factor analysis and pairedsamples T test, and to compare difference between different kinds of patients using ANOVA. Results The interests claims of patients can be summed up to six factors and there is no significant difference between different kinds of patients. Conclusion At current stage, public hospitals need improve medical technique and cut down medical expenses.

Objective To determine whether the candidates who were disqualified for having phoria or tropia in People′s Liberation Army Air Force ( PLAAF) medical selection of flying cadets are qualified or not according to United States Air Force ( USAF) Medical Standards Directory , and to raise suggestions on revising PLAAF medical standards . Methods All the candidates who had participated in the final medical selection of flying cadets were reevaluated and determined as qualified or not according to USAF Medical Standards Directory .Results There was a marked difference between disqualification rates of PLAAF and USAF .13.87%of the candidates who were regerded as disqualified by PLAAF standards were qualified according to USAF Medical Standards Directory .These cadets might be eliminated by mistake . Conclusion The standard on heterophonies of the PLAAF is more stringent than that of the USAF .We shoucd revise PLAAF standards using USAF standards for reference .

OBJECTIVETo identify the differentially expressed microRNAs (miRNAs) between esophageal squamous carcinoma (ESC) and adjacent non-tumorous tissue (NT).

METHODSThe expression levels of the miRNAs were detected in 3 fresh ESC and NT samples by hybridization with miRNAs microarray chip. Real-time quantitative RT-PCR was performed to confirm the results of the microarray analysis. The expressions of hsa-miR-126 and hsa-miR-518b in ESC were validated by real-time quantitative RT-PCR in another independent 15 matched samples.

RESULTSA total of 11 miRNAs exhibited differential expressions in ESC samples as compared to their expressions in the NT samples, including a 1 up-regulated miRNA and 10 down-regulated miRNAs. Compared with normal esophageal samples, the ESC tissues showed up-regulated hsa-miR-126 and down-regulated hsa-miR-518b expression.

CONCLUSIONhsa-miR-126 and hsa-miR-518b are differentially expressed in ESC, and they might play important roles in the carcinogenesis and progression of ESC.

Biomarkers, Tumor ; metabolism ; Carcinoma, Squamous Cell ; genetics ; pathology ; Esophageal Neoplasms ; genetics ; pathology ; Gene Expression Profiling ; methods ; Gene Expression Regulation, Neoplastic ; Humans ; MicroRNAs ; genetics ; Tumor Cells, Cultured

Objective:To analyze the clinical and immunological characteristics of children with acute viral infection-related encephalopathy.Methods:Case-control study.A retrospective analysis was conducted on the clinical data of children diagnosed with acute viral infection-related encephalopathy during hospitalization at the Children′s Hospital, Capital Institute of Pediatrics from January 2020 to January 2023.According to the last follow-up modified Rankin scale (mRS) score, these children were divided into a good prognosis group (mRS score ≤2) and a poor prognosis group (mRS score >2), and the clinical and immunological characteristics of the children with different prognoses were analyzed.The binary Logistic regression was used to analyze the risk factors for poor prognosis.Results:A total of 28 children with acute viral infection-related encephalopathy aged 4 months to 11 years were included.There were 16 males (57%) and 12 females (43%). Among the preinfection viruses, there were 16 children of Corona virus disease 2019, 8 children of influenza A virus, 3 children of influenza B virus, and 1 child of norovirus.Among them, there were 21 children with acute necrotizing encephalopathy, 4 children with acute encephalopathy with biphasic seizures and late reduced diffusion, 2 children with mild encephalitis with a reversible splenial lesion, and 1 child with hemorrhagic shock and encephalopathy syndrome.Among the first symptoms, 24 children (85.7%) had consciousness disorders, 23 children (82.1%) had seizures, 17 children (60.7%) had speech disorders, 11 children (39.3%) had involuntary movements, and 10 children (35.7%) had abnormal mental behavior.For the site of lesion, the cranial nuclear magnetic resonance imaging revealed 17 in the thalamus, 10 in the brainstem, 9 in the basal ganglia, 8 in the cerebellar hemisphere, and 4 in the corpus callosum.In the last follow-up evaluation, 17 children had a mRS score of >2, and 11 children had a mRS score of ≤2.Univariate analysis showed that disturbance of consciousness, seizure cluster, brain stem lesion, absolute value of serum T lymphocytes, cerebrospinal fluid(CSF) protein, CSF cytokines [interleukin(IL)-1β, IL-6 and IL-8]were higher in the poor prognosis group than those in the good prognosis group.Multivariate Logistic regression analysis indicated that brain stem disease, CSF IL-1β and T lymphocyte absolute number were independent risk factors for poor prognosis.Conclusions:Brain stem lesions, cerebrospinal fluid IL-1β and the absolute number of T lymphocytes have predictive value for the prognosis of acute viral infection-associated encephalopathy.The more severe the conditions, the lower the T lymphocytes, and the higher the cytokines in some cerebrospinal fluid.

Objective:To summarize the clinical manifestations, diagnosis, treatment and prognosis of acute flaccid myelitis (AFM) in children.Methods:Clinical characteristics of 4 AFM cases from Department of Neurology, Children′s Hospital Affiliated to Capital Institute of Pediatrics, from September 2018 to November 2022, were analyzed retrospectively.Results:The age of 4 children with AFM was 7 years, 4 years and 3 months, 7 years and 1 month, 6 years and 5 months, respectively. There were 2 boys and 2 girls. Prodromal infection status showed 3 children of respiratory tract infection and 1 child of digestive tract infection. The main manifestation was asymmetrical limb weakness after infection, and the affected limb range was from monoplegia to quadriplegia. Cranial nerve injury was involved in 1 child, no encephalopathy. Magnetic resonance imaging in the spinal cord of all 4 children showed long T1 and T2 signals, mainly involving gray matter. Cerebrospinal fluid cell-protein separation was observed in 2 children. Pathogen detected in 1 child pharyngeal swab was enterovirus D68. Antibody IgM to adenovirus was positive in the blood of 1 child. Antibody IgG against Echo and Coxsackie B virus were positive in the blood of another child. After glucocorticoid, human immunoglobulin or simple symptomatic treatment and at the same time under later rehabilitation training, muscle strength recovered to different degrees, but there were disabilities left in 3 children.Conclusions:AFM should be considered in children with acute and asymmetrical flaccid paralysis accompanied by abnormal magnetic resonance imaging signal in the central region of spinal cord, especially post-infection. The effective treatment is limited and the prognosis is poor.

Deficiency of adenosine deaminase 2(DADA2) is a rare monogenic autoinflammatory disorder caused by genetic variations in the ADA2 gene. The disease has complex clinical manifestations. The hematological involvement is infrequent in the disease. Therefore, the disease is frequently wrongly diagnosed and missed diagnoses. This article reports a case of a child patient with DADA2 who was admitted to the Peking Union Medical College Hospital. The child had aplastic anemia. After inadequate response to treatment with glucocorticoids, cyclosporine, and various supportive measures, the patient exhibited pancytopenia. Genetic testing showed a novel homozygous mutation in the ADA2 gene (NM_001282225.2:c.712_750dupGACAACGTGCTCTACATGGAGATCAGAGCCAGGCTGCTG), with reduced ADA2 levels in peripheral blood. Based on the testing results and clinical manifestations, the patient was diagnosed DADA2. Genetic testing and monitoring of ADA2 levels proved helpful in the early diagnosis of DADA2. Treatment protocol should base on the disease phenotype and severity, and include glucocorticoids, immunosuppressants, biological agents, and hematopoietic stem cell transplantation.