1.Pathogenic anlysis of 44 cases with ventilator-associated pneumonia in PICU
Hui CHEN ; Yujie QI ; Rong GENG ; Suyun QIAN ; Xiannan CHEN
Chinese Pediatric Emergency Medicine 2001;8(1):13-15
Objective To find out the morbidity and main pathogens of ventilator-associated pneumonia(VAP) in PICU.Methods 44 VAP cases were reviewed.Results 44 VAP cases were diagnosed and analyzed from 1998, 2 to 2001,1,the morbidity of VAP was 69.8%.The predominant pathogen was Pseudomonas aeruginosa.Conclusion It has reference value in consideri ng the possible pathogens of pneumonia.
2.Association between maternal blood lipid level during pregnancy and risk of small-for-gestational-age infants
CHEN Hui Qi ; LUO Qiong ; CHEN Guang Di
Journal of Preventive Medicine 2021;33(1):41-45
Small for gestational age ( SGA ),one of the major adverse pregnancy outcomes, significantly increases the risk of perinatal death and metabolic diseases in adulthood. It is of great significance to strengthen early surveillance and intervention for SGA prevention. Dyslipidemia during pregnancy, as a common metabolic disorder, has been considered to correlate with the increased risk of SGA; however, the epidemiological evidence is still controversial. We have systematically reviewed the recent studies related to the association between serum lipid level during pregnancy and the risk of SGA, so as to provide reference for prevention and intervention of SGA.
3.Research and Progress on Feed Phytase Reform by Protein Engineering
Hui CHEN ; Hong-Ning WANG ; Qi WU ; Hai-Xia ZHAO ;
Microbiology 1992;0(03):-
As a kind of additive in feed of monogastric animals, the application of natural phytase is limited due to its disadvantages. In this paper, the strategies of phytse reform was introduced. Furthermore, the research and progress on protein engineering of feed phytase was reviewed, including phytase over-expression, phytase thermostability, catalytic efficiency and optimum pH.
4.Study on a antepartum immunoprophylaxis to interrupt the transmission of hepatitis B virus from mother to infant
Hui YU ; Qi-Rong ZHU ; Su-Qing CHEN ;
Chinese Journal of Infectious Diseases 2001;0(06):-
Objective To investigate the efficacy and the mechanism of different dose hepatitis B immunoglohulin(HBIG)on prevention of HBV intrauterine infection and HBV S gene mutation. Methods HBV carrier mothers were randomly divided into three groups.Eighty-one HBsAg carrier pregnant women were divided into HBIG A group.HBIG B group and control group.Each subject in the HBIG A group received 200 U or 400 U(for HBsAg and HBeAg double positive carrier)intra muscularly at 3,2,1 month before delivery.Each subject in the HBIG B group received 200 U intra muscularly at 3,2,1 month before delivery.The subjects in the control group did not receive any treatment.Maternal blood samples were taken before HBIG injection and at delivery.Neonatal blood samples of all newborn infants after birth were taken before immunopropbylaxis.Their sera were ob tained to test HBV markers by enzyme immunoassay(EIA)and HBV DNA by fluorescence quantita- tive polymerase chain reaction(FQ-PCR),then to amplify and sequence HBV S gene region.Results The rate of HBV intrauterine infection in the HBIG group(14.5%)was lower than that in the control group(35.7%)(X~2=4.896,P=0.027).The rate of HBV intrauterine infection of newborns from HBsAg and HBeAg double positive carrier mother in the HBIG A group(37.5%)were lower than control group(100.0%)(X~2=7.273,P=0.007),while the rate was no different in the HBIG B group(71.5%)and the control group(X~2=2.637,P=0.104).Maternal HBsAg titer and HBV DNA level were of no difference among three groups before HBIG injection.Maternal HBsAg titers and HBV DNA levels of the HBIG A group were lower than those of the HBIG B group and the con- trol group at delivery.Among the 26 neonatal serum samples in the HBIG A group,10(38.5%)were positive for anti-HBs,while in the HBIG B group and in the control group,no neonatal serum sam- ples was positive.There was no significant difference of nucleotide and amino acid changes in the S gene between the HBIG group and the control group.Conclusions HBV infection in the uterus may be interrupted by injection HBIG intramuscularly before delivery.More efficacy would be found using variable HBIG dose according to different HBV virema and must be once more again injected just he- fore one week of delivery;anti-HBs transported to the fetus via the placenta and it's may be the im- portant mechanism of HBIG prevention.Asymptomatic HBsAg carrier mother received injections of HBIG before delivery should not influence HBV S gene mutation.Gene mutation of HBV is not the main factor in intrauterine transmission of HBV.
5.Studies on chemical constituents of cytotoxicity portion in bark of Reevesia longipetiolat
Hui ZHU ; Pengfei TU ; Qi CHEN ; Anlong XU ;
Chinese Traditional and Herbal Drugs 1994;0(11):-
Object To study the chemical constituents of cytotoxicity portion in the bark of Reevesia longipetiolata Merr et Chun Methods The constituents were isolated and purified by various chromatographic methods, such as gel column chromatography under normal pressure and increased pressure, Sephadex LH 20 column chromatography and HPLC, and the structures were identified by physicochemical properties and spectral analysis Results Five compounds were obtained in the ethyl acetate fractions and identified as ? sitosterol (Ⅰ), daucosterol (Ⅱ), betulinic acid (Ⅲ), lupeol (Ⅳ) and (+) catechin (Ⅴ) Conclusion All above compounds are obtained from the plants of Reevesia Lindl for the first time, and their cytotoxicity is discussed
6.Status of knowledge and performance of chronic heart failure guideline in general practitioners of Shanghai Pudong communities
Lan NI ; Hui ZHAO ; Jinhua XUE ; Qi XU ; Fengyuan CHEN
Chinese Journal of General Practitioners 2015;14(5):351-357
Objective To investigate the status of knowledge and performance on Chinese Heart Failure Diagnosis and Treatment Guideline (2014 version) in general practitioners of Shanghai Pudong communities.Methods The survey was conducted from April to June in 2014 with a self-designed questionnaire.Total 390 general practitioners (GPs) in Pudong New Area were selected by cluster sampling method.The contents of questionnaire included:diagnosis and differential diagnosis,drug therapy,non drug therapy of chronic heart failure.Result Total 385 questionnaires were retrieved with a response rate of 98.7% (385/390).The results showed that in aspect of diagnosis and differential diagnosis,373 (96.9%) Gps made the diagnosis based on history and physical examination,171 (44.4%)Gps never used BNP or NTPro-BNP tests,280 (72.7%)GPs did not know how to identify systolic or diastolic heart failure,86 (22.3%)Gps made the differential diagnosis according to the EF value.In aspects of drug therapy,the rate of beta blockers use was 10%-30% in 284 (73.8%) Gps,149 (38.7%) Gps did not use beta blockers because of not knowing the contraindications,289 (75.1%) Gps used a maximum dose of betaloc for 25-50 mg,no one used 101-200 mg,242 (62.9%)Gps did not know the target dose of betaloc,the rate of ACEI/ARB use was 10%-30% in 330 (85.7%) Gps,258 (67.0%) Gps would increase the dose but not knowing the target dose.The main reason for not using the target dose of Betaloc and ACEI/ARB was not knowing the dose.In aspect of non-drug therapy:240 (62.3%)Gps never heard of cardiac resynchronization therapy (CRT) and 271 (70.4%)Gps never heard of implantable cardioverter defibrillator (ICD).The senior rank GPs grasped the guideline much better than Gps with primary and intermediate professional ranks.Conclusion General practitioners in community health centers should further study the guideline of heart failure,particularly need to strengthen the knowledge and ability of drug therapy.
7.Effect of acupoint massage on blood glucose and pregnancy outcome in diabetic patients during pregnancy
Shujuan LI ; Hui GUO ; Huizhi QI ; Lijun CHEN
Chinese Journal of Primary Medicine and Pharmacy 2014;(23):3555-3557,3558
Objective To observe the acupoint massage on gestational diabetes about mellitus and pregnancy outcome.Methods Using simple random sampling method,96 cases of gestational diabetes mellitus were randomly divided into the observation group and control group.The control group were given the conventional treatment, the observation group were given acupoint massage,pregnancy outcomes and blood glucose in the two groups before and after intervention were compared.Results The two groups after treatment of fasting blood glucose,2h postprandial blood glucose and glycated hemoglobin levels were significantly lower than that those of before treatment, but the observation group[(6.92 ±0.66)mmol/L,(8.12 ±0.70)mmol/L,(6.88 ±0.39)%]improved significantly better than those of the control group[(7.93 ±1.03)mmol/L,(9.54 ±1.33)mmol/L,(7.95 ±0.63)%],the difference was statistically significant(t =3.27,2.39,2.73,all P<0.05).The observation group after treatment,the 2H C peptide levels in fasting serum C peptide and postprandial[(0.50 ±0.07)nmol/L,(0.54 ±0.06)nmol/L]signifi-cantly increased than those of the control group after treatment[(0.38 ±0.04)nmol/L,(0.49 ±0.04)nmol/L],with statistical significant differences(t=2.41,2.15,P<0.05).The patients in the control group after treatment,statistical average daily insulin dosage was (55.84 ±8.73) u,the observation group was (32.24 ±5.03) u,the observation group was significantly lower than that of the control group,the difference was statistically significant(t=13.84,P<0.05).The observation group cesarean section,polyhydramnios,postpartum hemorrhage,fetal distress,pregnancy induced hypertension incidence rate(12.50%,4.17%,2.08%,4.17%,0%) were lower than those of the control group(29.17%,16.67%,12.50%,22.92%,12.50%),the difference was statistically significant(χ2 =4.042, 3.877,3.852,7.206,6.400,all P<0.05).Conclusion The acupoint massage therapy can effectively enhance the gestational diabetes treatment effect,improve the pregnancy outcome in patients with gestational diabetes mellitus.
8.Implication of expression of Nanog in prostate cancer cells and their stem cells.
Chen, GONG ; Hui, LIAO ; Fengjin GUO ; Liang, QIN ; Jun, QI
Journal of Huazhong University of Science and Technology (Medical Sciences) 2012;32(2):242-6
Recent studies suggested that the prostate cancer may arise from prostate cancer stem cells that share some same characteristics with normal stem cells. The purpose of this study was to detect the differences of Nanog expression between PC3 prostate cancer cell line and its tumor stem cells, and the relationship was preliminarily examined between Nanog and prostate cancer and its tumor stem cells. By using magnetic active cell sorting (MACS), we isolated a population of CD44(+)/CD133(+) prostate cancer cells that display stem cell characteristics from PC3 cell line. Immunohistochemistry revealed positive expressions of CD44, CD133 and α(2)β(1)-integin in the isolated cells. CCK-8 analysis showed that isolated cells had a strong proliferative ability. The formation of the cell spheres in serum-free medium and holoclones in serum-supplied medium showed that the cells were capable of self-renewing, indicating that the isolated cells were a population of cancer stem-like cells derived from PC3 cell line. Western blotting exhibited that the isolated cells had higher experession of Nanog, an embryonic stem marker, as compared with PC3 cells. Our study showed that Nanog might be helpful in sustaining the self-renewal and the undifferentiation of prostate cancer stem cells, and may serve as a marker for prostate cancer stem cells for isolation and identification.
9.Clinical analysis of peripancreatic vascular abnormalities complicated with pancreatitis
Hui YAO ; Xiaozhong GUO ; Xingshun QI ; Jiang CHEN
Chinese Journal of Pancreatology 2017;17(3):158-161
Objective To determine the prevalence and clinical features of peripancreatic vascular abnormalities in patients with pancreatitis.Methods The clinical data of 102 pancreatitis patients between January 2013 to December 2014 in the General Hospital of Shenyang Military Command who underwent contrast enhanced CT or contrast enhanced MRI scans were retrospectively analyzed.The radiological features of peripancreatic vascular abnormalities in such patients were examined, and the clinical features of pancreatitis patients with or without peripancreatic vascular abnormalities were investigated.Results Peripancreatic vascular abnormalities were found in 18 patients(17.6%), and vascular abnormalities were relatively common in portal vessels.No significant differences were observed on the age at onset, gender ratio, smoking status, alcohol consumption and length of stay between patients with and without peripancreatic vascular abnormalities.Compared with those without peripancreatic vascular abnormalities, patients with peripancreatic vascular abnormalities had a significantly higher incidence of peripancreatic fluid collection, pancreatic pseudocyst and gastric varices, and the differences were statistically significant(all P<0.05).Conclusions Peripancreatic vascular abnormalities can be complicated with pancreatitis.Enhanced CT or enhanced MRI were valuable in the diagnosis.Pancreatic pseudocyst, peripancreatic fluid collection and gastric varices were more common in pancreatitis complicated with peripancreatic vascular abnormalities.
10.Study of ?-defensin rBD-2 gene expression in the pulmonary tissues of the fetal, neonatal and adult rats
Hui ZHOU ; Ning HUANG ; Xinnian CHEN ; Qi WU ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(03):-
AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.