Objective　To find out the morbidity and main pathogens of ventilator-associated pneumonia(VAP) in PICU.Methods　44 VAP cases were reviewed.Results　44 VAP cases were diagnosed and analyzed from 1998, 2 to 2001,1,the morbidity of VAP was 69.8%.The predominant pathogen was Pseudomonas aeruginosa.Conclusion　It has reference value in consideri ng the possible pathogens of pneumonia.

Small for gestational age ( SGA ),one of the major adverse pregnancy outcomes, significantly increases the risk of perinatal death and metabolic diseases in adulthood. It is of great significance to strengthen early surveillance and intervention for SGA prevention. Dyslipidemia during pregnancy, as a common metabolic disorder, has been considered to correlate with the increased risk of SGA; however, the epidemiological evidence is still controversial. We have systematically reviewed the recent studies related to the association between serum lipid level during pregnancy and the risk of SGA, so as to provide reference for prevention and intervention of SGA.

Objective To evaluate the effect of electro-acupuncture pretreatment on endoplasmic reticulum stress during global cerebral ischemia-reperfusion (I/R ) in rats .Methods One hundred and forty-four adult male Sprague-Dawley rats ,weighing 400-500 g ,were randomly divided into 3 groups ( n=48 each) using a random number table:sham operation group (group S ) , I/R group and electro-acupuncture pretreatment group (group EA) .Global cerebral I/R was induced by 4-vessel occlusion method .Bilateral vertebral arteries were permanently occluded by cauterization and bilateral carotid arteries were occluded for 5 min , followed by reperfusion .Electro-acupuncture of Dazhui and Baihui acupoints lasting for 30 min was performed once a day for 5 consecutive days starting from 5 days before ischemia in group EA .At 6 ,12 ,24 and 48 h of reperfusion ,12 rats were sacrificed in each group and hippocampi were removed for microscopic examination and for determination of apoptosis rate (by TUNEL ) and expression of growth arrest-and DNA damage-inducible gene 153 (GADD153 ) protein (by Western blot ) .Results Compared with group S ,the apoptosis rate was significantly increased and the expression of GADD153 protein was up-regulated at 6 ,12 ,24 and 48 h of reperfusion in I/R and EA groups ( P<0.05) .Compared with group I/R ,the apoptosis rate was significantly decreased and the expression of GADD 153 protein was down-regulated at 6 ,12 ,24 and 48 h of reperfusion in group EA ( P< 0.05) .The pathological changes were significantly attenuated in group EA as compared with group I/R .Conclusion Electro-acupuncture pretreatment can down-regulate the expression of GADD 153 protein , reduce endoplasmic reticulum stress , and decrease cell apoptosis ,thus attenuating global cerebral I/R injury in rats .

Accidents, Occupational ; statistics & numerical data ; Adolescent ; Adult ; Aged ; Female ; Follow-Up Studies ; Hand Injuries ; epidemiology ; etiology ; Humans ; Male ; Middle Aged ; Prognosis ; Retrospective Studies ; Young Adult

Objective To study the effect of total nutrient admixture (TNA) on lipid metabolism in rats with acute hepatic failure (AHF). Methods Fifty-six male Wistar rats were randomly divided into four groups: normal diet group, nitrogen-free diet group, fat-free nutrient admixture group, and TNA group. All rats were injected with D-galac- tosamine to induce AHF model Meanwhile, 6 healthy Wistar rats were used as control group. TNA provided energy 221.75 kJ (1 kcal=4.184 kJ), nitrogen 0.365 g, nitrogen to energy ratio 1:145, amino acids 2.28 g (including branched-chain amino acid 0.70 g), glucose 7.85 g, and fat 1.25 g on a daily basis. After 10 days of the operation of Jugular vein puncture tube, blood glucose, blood lipid, liver and renal function were determined. Results The blood glucose level was significantly higher in TNA group than that in fat-free nutrient admixture group (P < 0.05). The levels of serum triglyceride and cholesterol were highest in fat-free nutrition admixture group, and triglyceride level was signif- icantly higher than that in normal diet group and nitrogen-free diet group (P <0.05). The levels of serum triglyceride and cholesterol were significantly higher in TNA group than those in normal diet group (P <0.05). The levels of ala- nine aminotransferase, alkaline phosphatase, total bilirubin and blood urea nitrogen were lower in TNA group than those in fat-free nutrient admixture group (P < 0.05). Conclusion The nutritional proportion of TNA is suitable for the metabolism disorder of hepatic failure, and therefore TNA can reasonably promote the anabolism and reverse the deteri- oration of hepatic failure in rats.

AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.

Recent studies suggested that the prostate cancer may arise from prostate cancer stem cells that share some same characteristics with normal stem cells. The purpose of this study was to detect the differences of Nanog expression between PC3 prostate cancer cell line and its tumor stem cells, and the relationship was preliminarily examined between Nanog and prostate cancer and its tumor stem cells. By using magnetic active cell sorting (MACS), we isolated a population of CD44(+)/CD133(+) prostate cancer cells that display stem cell characteristics from PC3 cell line. Immunohistochemistry revealed positive expressions of CD44, CD133 and α(2)β(1)-integin in the isolated cells. CCK-8 analysis showed that isolated cells had a strong proliferative ability. The formation of the cell spheres in serum-free medium and holoclones in serum-supplied medium showed that the cells were capable of self-renewing, indicating that the isolated cells were a population of cancer stem-like cells derived from PC3 cell line. Western blotting exhibited that the isolated cells had higher experession of Nanog, an embryonic stem marker, as compared with PC3 cells. Our study showed that Nanog might be helpful in sustaining the self-renewal and the undifferentiation of prostate cancer stem cells, and may serve as a marker for prostate cancer stem cells for isolation and identification.

Objective To investigate the status of knowledge and performance on Chinese Heart Failure Diagnosis and Treatment Guideline (2014 version) in general practitioners of Shanghai Pudong communities.Methods The survey was conducted from April to June in 2014 with a self-designed questionnaire.Total 390 general practitioners (GPs) in Pudong New Area were selected by cluster sampling method.The contents of questionnaire included:diagnosis and differential diagnosis,drug therapy,non drug therapy of chronic heart failure.Result Total 385 questionnaires were retrieved with a response rate of 98.7％ (385/390).The results showed that in aspect of diagnosis and differential diagnosis,373 (96.9％) Gps made the diagnosis based on history and physical examination,171 (44.4％)Gps never used BNP or NTPro-BNP tests,280 (72.7％)GPs did not know how to identify systolic or diastolic heart failure,86 (22.3％)Gps made the differential diagnosis according to the EF value.In aspects of drug therapy,the rate of beta blockers use was 10％-30％ in 284 (73.8％) Gps,149 (38.7％) Gps did not use beta blockers because of not knowing the contraindications,289 (75.1％) Gps used a maximum dose of betaloc for 25-50 mg,no one used 101-200 mg,242 (62.9％)Gps did not know the target dose of betaloc,the rate of ACEI/ARB use was 10％-30％ in 330 (85.7％) Gps,258 (67.0％) Gps would increase the dose but not knowing the target dose.The main reason for not using the target dose of Betaloc and ACEI/ARB was not knowing the dose.In aspect of non-drug therapy:240 (62.3％)Gps never heard of cardiac resynchronization therapy (CRT) and 271 (70.4％)Gps never heard of implantable cardioverter defibrillator (ICD).The senior rank GPs grasped the guideline much better than Gps with primary and intermediate professional ranks.Conclusion General practitioners in community health centers should further study the guideline of heart failure,particularly need to strengthen the knowledge and ability of drug therapy.

Objective To investigate the clinical efficacy of ultrasound-guided double-tract percutaneous cholecystostomy combined with choledochoscopic gallbladder-preserving cholecystolithotomy for the elderly patients with acute calculous cholecystitis.Methods The clinical data of 35 elderly patients with cholecystolithiasis who were admitted to the General Hospital of Chengdu Military Command from January 2012 to December 2013 were retrospectively analyzed.All the 35 patients received ultrasound-guided double-tract percutaneous drainage,and then received choledochoscopic gallbladder-preserving cholecystolithotomy.The long-term oral use of anti-inflammatory and cholagogue medications after operation reduced recurrence of cholecystolithiasis.All the patients were followed up by telephone interview and outpatient examination till June 30,2014.Results All the 35 patients undergoing successfully the ultrasound-guided double-tract percutaneous cholecystostomy.Of the 35 patients,1 patient with the puncture bleeding was cured successfully by symptomatic treatment,1 patient was treated by cholecystectomy due to the unformed sinus tract under costal margin,and other 34 patients underwent successfully cholecystolithotomy.The follow-up was carried out for 4 to 24 months and 1 patient was diagnosed as with recurrence of cholecystolithiasic.Conclusion Ultrasound-guided double-tract percutaneous cholecystostomy combined with choledochoscopic gallbladder-preserving cholecystolithotomy for elderly patients with acute calculous cholecystitis is safe and feasible,with an advantage of promotional value.

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.