No abstract available.
CHARGE Syndrome ; Humans ; Indonesia

CHARGE syndrome (coloboma, heart defects, atresia choanae, retarded growth and development, genital hypoplasia, and ear abnormalities) is characterized by multiple malformations and is diagnosed using distinct consensus criteria. Mutations in the gene encoding chromodomain helicase DNA-binding protein 7 (CHD7) are the major cause of CHARGE syndrome. Clinical features of CHARGE syndrome considerably overlap those of 22q11.2 deletion syndrome. Of these features, immunodeficiency and hypocalcemia are frequently reported in patients with 22q11.2 deletion syndrome but are rarely reported in patients with CHARGE syndrome. In this report, we have described the case of a patient with typical phenotypes of 22q11.2 deletion syndrome but without the proven chromosome microdeletion. Mutation analysis of CHD7 identified a pathogenic mutation (c.2238+1G>A) in this patient. To our knowledge, this is the first case of CHARGE syndrome with immunodeficiency and hypocalcemia in Korea. Our observations suggest that mutation analysis of CHD7 should be performed for patients showing the typical phenotypes of 22q11.2 deletion syndrome but lacking the proven chromosome microdeletion.
CHARGE Syndrome* ; Consensus ; DiGeorge Syndrome ; Ear ; Growth and Development ; Heart ; Humans ; Hypocalcemia* ; Korea ; Nasopharynx ; Phenotype

BACKGROUND AND OBJECTIVES: The bilateral choanal atresia is a medical emergency for which surgery is the only and definite treatment. We performed an atretic bone perforation using Hagers dilators. The purpose of this study, then, is to evaluate the efficacy of this simple technique of perforation, dilation and stenting. MATERIAL AND METHODS: We studied five patients who underwent surgery for a complete bilateral bony atresia from 1994 to 2004. All the patients were newborn: two males and three females babies. The male female ratio was 1 : 1.5. Their age varied from 1 day to 4 days. The surgery was performed with Hagers dilators using the puncture and dilation technique. Stenting was carried out in all cases using a non cuffed endotracheal tube. RESULTS: The reestablishment of the nasal passage through a perforating atretic plate was considered a successful criteria of surgery. All the neonates had good nasal air passage after the perforation, dilation and stenting. Two of the patients who were with the CHARGE association died within 7 days due to causes unrelated to surgery. The other three patients had successful removal of stent after six weeks. There was no follow-up afterwards. CONCLUSION: The puncture, dilation and stenting technique by Hagers dilator is safe, quick and simple. It involves minimum blood loss and is without any complications. Stenting, therefore, is essential for preventing restenosis.
CHARGE Syndrome ; Choanal Atresia* ; Emergencies ; Female ; Follow-Up Studies ; Humans ; Infant, Newborn ; Male ; Punctures* ; Stents*

The acronym CHARGE (Coloboma, Heart defects, Atresia choanae, Retarded growth and development, Genital hypoplasia, and Ear abnormalities) was coined by Pagon et al. in 1981. The prevalence of CHARGE syndrome was estimated to be approximately 1/10,000 - 1/15,000. The cause of the CHARGE syndrome remains unknown but several observations support the role of genetic factors and a significantly higher paternal age at conception and several chromosomal abnormalities. The clinical spectrum of this multiple congenital anomaly and mental retardation is broad and variable, therefore the treatment of the CHARGE syndrome was not definitive and conservative. We hereby report, with reviewing other literature, a case of CHARGE syndrome diagnosed after delivery.
CHARGE Syndrome* ; Chromosome Aberrations ; Ear ; Fertilization ; Growth and Development ; Heart ; Intellectual Disability ; Nasopharynx ; Numismatics ; Paternal Age ; Prevalence

CHARGE syndroine, first described by Pagon, was named for its six dominant clinical features. They are coloboma of the eye, heart defects, atresia of the choanae, retarded growth and development including CNS anomalies, genital hypoplasia and/or urinary anomalies, and ear anormalies and/or hearing loss, We report a case of CHARGE syndrome with choanal atresia and ear anomalies in the otorhinolaryngologic field, with a review of the previously reported literature concerning CHARGE syndrome.
CHARGE Syndrome* ; Choanal Atresia ; Coloboma ; Ear ; Growth and Development ; Hearing Loss ; Heart ; Nasopharynx

Bilateral choanal atresia is a rare disorder characterized by bilateral obstruction of the posterior end of the nasal cavity. It can be present in isolation or associated with multiple disorders such as coloboma, heart defect, choanal atresia, retarded growth, genital hypoplasia, ear abnormalities (CHARGE) syndrome. Because congenital bilateral choanal atresia presents as respiratory distress at birth, immediate diagnosis and adequate treatment is required. Traditionally, using stents was a part of the postoperative treatment to provide a low rate of restenosis but recently it is controversial. Currently nasal endoscopic approach is mainly used with or without stenting. We report a case of CHARGE syndrome with bilateral choanal atresia treated by transnasal endoscopic approach without stenting.
CHARGE Syndrome ; Choanal Atresia* ; Coloboma ; Diagnosis ; Ear ; Heart ; Nasal Cavity ; Parturition ; Stents*

OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome. METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. CONCLUSION Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
CHARGE Syndrome/genetics* ; Child ; DNA Helicases/genetics* ; DNA-Binding Proteins/genetics* ; Genetic Variation ; Humans ; Mutation ; Phenotype

CHARGE syndrome has been estimated to occur in 1:10,000 births worldwide and shows various clinical manifestations. It is a genetic disorder characterized by a specific and a recognizable pattern of anomalies. The major clinical features are ocular coloboma, heart malformations, atresia of the choanae, growth retardation, genital hypoplasia, and ear abnormalities. The chromodomain helicase DNA-binding protein 7 (CHD7) gene, located on chromosome 8q12.1, causes CHARGE syndrome. The CHD7 protein is an adenosine triphosphate (ATP)-dependent chromatin remodeling protein. A total of 67% of patients clinically diagnosed with CHARGE syndrome have CHD7 mutations. Five hundred twenty-eight pathogenic and unique CHD7 alterations have been identified so far. We describe a patient with a CHARGE syndrome diagnosis who carried a novel de novo mutation, a c.3896T>C (p. leu1299Pro) missense mutation, in the CHD7 gene. This finding will provide more information for genetic counseling and expand our understanding of the pathogenesis and development of CHARGE syndrome.
Adenosine Triphosphate ; CHARGE Syndrome* ; Chromatin Assembly and Disassembly ; Coloboma ; Diagnosis ; Ear ; Genetic Counseling ; Heart ; Humans ; Mutation, Missense ; Nasopharynx ; Parturition

CHARGE syndrome is a rare genetic disorder with CHD7 gene mutation. CHARGE is an acronym for coloboma (C), heart disease (H), atresia of choanae (A), retardation of growth (R), genitourinary malformation (G), and ear abnormalities (E). Patients with CHARGE syndrome need to undergo many surgeries due to their various congenital anomalies. Since airway abnormalities frequently accompany CHARGE syndrome, general anesthesia remains a challenge. Here we report a case of difficult intubation in a 35-month-old boy with CHARGE syndrome during general anesthesia and the experience of successful intubation using D-blade of C-MAC® video laryngoscope.
Airway Management ; Anesthesia, General ; CHARGE Syndrome* ; Child* ; Child, Preschool ; Coloboma ; Ear ; Heart Diseases ; Humans ; Intubation* ; Laryngoscopes* ; Male ; Nasopharynx ; Pediatrics

OBJECTIVETo analyze two Chinese pediatric patients with multiple malformations and growth and development delay.

METHODSBoth patients were subjected to targeted gene sequencing, and the results were analyzed with Ingenuity Variant Analysis software. Suspected pathogenic variations were verified by Sanger sequencing.

RESULTSHigh-throughput sequencing showed that both patients have carried heterozygous variants of the CHD7 gene. Patient 1 carried a nonsense mutation in exon 36 (c.7957C>T, p.Arg2653*), while patient 2 carried a nonsense mutation of exon 2 (c.718C>T, p.Gln240*). Sanger sequencing confirmed the above mutations in both patients, while their parents were of wild-type for the corresponding sites, indicating that the two mutations have happened de novo.

CONCLUSIONTwo patients were diagnosed with CHARGE syndrome by high-throughput sequencing.

CHARGE Syndrome ; genetics ; DNA Helicases ; genetics ; DNA-Binding Proteins ; genetics ; Genetic Testing ; High-Throughput Nucleotide Sequencing ; Humans ; Infant ; Male ; Mutation