A number of low molecular weight cationic peptides, named defensins,were purified from neutrophil granuals. Its in vitro cytotoxicity to HL-60 cell line anddirect viral inactivation were examined. The results showed that when incubated with NP-1 and NP-2(100?g/ml) fot 6 hours, more than 60% of HL-60 cells were killed. WhenHerpes simplex virus type I(HSy-I) and influenza virus B strain Beijing 87-1 wereincubated with NP-1(260?g/ml) at 37?C in water bath for 60 min, a marked reduction(98.2% and 90% ) in virus TCID_50 was observed. The results suggested that neutrophilgranulocyte might be able to synthesize peptides which have the cytotoxic and antiviralacitivities.

Toll signaling pathway may play a curcial role in induction of inflammation-associated gene activation. Originally, the Toll/spaetzle/Cactus-Dorsal signaling pathway is established in the Drosophila embryonic development. Recently, the Toll signaling pathway in adult Drosophila has been established in the induction of antimicrobial peptide expression. Five human Toll-like receptor genes (h Tlr l-5 ) and one mouse Toll-like receptor gene (m Tlr-4 ) have been isolated. Toll and Toll-like receptor genes encoded molecules are transmembrane proteins with an extracellular leucine repeat domain and a cytoplasmic domain homologous to IL-1 receptors. The intracellular signaling cascade involves Tube, Pelle, and Cactus-Dorsal complex in Drosophila, and MyD88, IRAK, TRAF 6, NIK, ??-I ?B kinase, and I ?B -NF?B complex in mammals. Dorsal and NF?B are transcription factors, while Cactus and I?B are their inhibitors. When the inhibitors phosphorylated, the nuclear factors are released and move into nucleus, leading to immune gene activation. It has been shown from in vitro system that Tlr -4 mediated LPS signaling in human monocytes for expression of IL-1, IL-6, IL-8, and costimulator B7-1 which provides second signal for T cell response. Tlr -2 can also mediate LPS signaling in human monocytes, leading to the production of proinflammatory mediators. Microbial lipoproteins are potent stimulators of IL-12 production through Tlr -2 signaling by human macrophages, and can stimulate Tlr 2-dependent transcription of inducible nitric oxide synthase and the production of nitric oxide, a powerful microbicidal pathway. Findings of a point mutation of Tlr-4 in LPS tolerant C3H/HeJ mouse strain and a deletion of Tlr-4 in LPS resistant C57BL/10ScCr mice provide an in vivo evidence strongly supporting the crucial role of Tlrs in LPS mediated inflammation. It is proposed that targeting Tlrs would develop new remedies for treatment of inflammatory disorders and for immunotherapy of mucosal infections and cancer, etc.

Objective Minimally invasive treatment of orthopedic diseases is the general direction of future development of medicine.This study was designed to observe the effect of manual reduction combined with percutaneous kyphoplasty (MR+PKP) in the treatment of fresh osteoporotic vertebral compression fractures ( OVCF) in elderly patients. Methods Sixty OVCF patients aged 60-86 ( mean 72.3) years were randomly assigned to 2 groups of e-qual number to be treated by MR+PKP and PKP alone, respectively. Comparisons were made between the two groups of patients in the op-eration time, volumeand permeability of the bone cement injected,changes of the Cobb angle,restoration of the anterior height of the compressed vertebral bodies,pre-and post-operative Visual Analogue Scale ( VAS) pain scores, OswestryDisability Indexes ( ODIs) , and other differences observed before and aftersurgery. Results Op-erations were performed successfully in all the 60 cases.In the MR+PKP group, the mean operation time was 61 min, the mean volume of bone cement injected was 5.1mL with qualified distribution, and bone cement leakage occurred in 1 case without adverse reaction. Statistically significant differences were found in the pre-and post-operativeanterior height of the compressed vertebral bodies, Cobb an-gle, VAS scores, and ODIs (P<0.05).Compared with the PKP control, MR+PKP achieved a significant increase at 3 days and 3 months after surgery in the anterior height of the compressed vertebral bodies ([22.4±1.4] vs [26.8±8.1] mm and [21.4±4.2] vs [26.5±7.2]mm, P<0.05), and a decrease in the Cobb angle ([8.6±2.7] vs [8.1±2.1]°and [9.0±2.3] vs [8.3±1.8]°, P<0.05) as well as remarkably reduced VAS scores (4.1±2.2vs 3.1±2.0, P<0.05)and ODIs (23.0±3.1vs25.6±3.3, P<0.05) at 3 d postopera-tively. Conclusion MR+PKP, with its advantages of effective pain-relief, improvement of the height of compressed vertebral bodies, and reduction of bone cement leakage,is better than PKP alone for the treatment of OVCF in elderly patients.

AIM: To examine the role of TLR-4 signaling pathway in laminar low shear stress-induced IL-8 gene expression in ECV304 cells. METHODS: RT-PCR and PCR were used to amplify a TLR4 mutant (lacking the 155 COOH terminal amino acids of the wild type TLR4 ) and-102-+61 bp 5′-flanking region of IL-8 gene (IL8 USCS)from endothelial cells. These two DNA fragments were cloned into pcDNA3 and pEGFP1, respectively, and the recombinant plasmid pcDNA3-mTLR4 and pEGFP1-IL8USCS were obtained. ECV304 cells were transfected with the pEGFP1-IL8USCS or co-transfected with pEGFP1-IL8USCS and pcDNA3-mTLR4 by using Dosper liposomal transfectional reagent and selected by G418, and then stimulated by 4 2 dyne/cm 2 shear stress for 3 hours. The green fluorescent protein expression was analyzed by Flow Cytometry. Immunoblotting of the cell lysates and NF-?B p65 immunocytofluorescent staining were used to determine I?B phosphorylation, degradation and NF-?B activation. RESULTS: Flow Cytometric analysis showed that when exposed to 4 2 dyne/cm 2 shear stress for 3 hours, there was a marked increase in the enhanced green fluorescent protein expression in pEGFP1-IL8USCS-transfected ECV304 cells. In contrast, there was almost no change in the green fluorescent protein expression in the cells co-transfected with pEGFP1-IL8USCS and pcDNA3-mTLR4 after the stimulation. Western blot analysis showed that a markedly increased p-I?B of cell lysates occurred at 10 min of exposure and the blot density almost dropped down to the baseline after 60 min of exposure. The density of I?B blot dropped down with increasing exposure time. NF-?B p65 immunocytofluorescent staining of ECV304 cells showed that when exposed to the same flow shear stress for 0 5,1 hours, the cell nuclei became staining, and after 1 5 or 2 hours, the staining was very strong. CONCLUSION: These results suggested that the inflammatory TLR-4/NF-?B signaling pathway may be involved in flow shear stress-induced IL-8 gene expression in human vascular endothelial cells.

AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.

AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.

AIM: To study the regulation of rat ?-defensin-2 gene expression by bacteria.METHODS: E.coli ML-35 p and pseudomonas aeruginosa were injected into rat trachea. Total RNA was isolated from lung tissue after 24 h inoculation. RT-PCR and Northern blot were performed to detect ?-defensin-2 ( rBD-2 ) mRNA expression.RESULTS: The expression of rBD-2 gene was inhibited in the lung tissue by E.coli infection, but not by pseudomonas aeruginosa. CONCLUSION: These results indicated that E.coli infection could down-regulate rBD-2 gene expression in the rat lung tissues.

Objective:To evaluate a Meta-analysis of randomized controlled trials ( RCTs) in multiple sclerosis ( MS) patients to evaluate the efficacy of vitamin D as add-on therapy. Methods: Searched Pubmed,EMbase,the Cochrane Library,CNKI,Wanfang Data base and so on up to february 2016 using the keywords:multiple sclerosis or MS and the drug names:vitamin D orCholecalciferol. Two authors independently selected the articles and extracted the data. We performed meta-analysis using Review Manager ( RevMan) version 5. 3 software. Results:Four RCTs with a total of 247 patients were selected.①Compared to the placebo, the EDSS score[MD=-0. 33,95% Confidence interval (CI)= (0. 68,0. 01),P=0. 05],the annual relapse rate[MD=-0. 08, 95%CI=(-0.37,0.21),P=0.60]and the number of gadolinium-enhancing lesions[MD=-0.16,95%CI=(-0.57,0.25),P=0. 45] showed no significant difference at 12 months,meanwhile the EDSS score[MD=-0. 48,95%CI=(0. 87,-0. 09),P=0. 02] and the annual relapse rate[MD=-0. 27,95%CI=(-0. 52,-0. 02),P=0. 03] were significantly less in the vitamin D group at 24 months.②Safety evaluation:There was no hypercalcaemia in vitamin D treated patients in each studies,main adverse events reported were diarrhoea, fever, constipation, dyspepsia, headache and so on. These symptoms were mild, after stopping drug can relieve the general. Conclusion: Vitamin D as an added in the treatment of MS showed as same as the placebo in some clinical indicators. However,after a longer treatment, the clinical indicators were significantly lower in the vitamin D group. Due to limited quantity and quality of the included studies,further larger and more prolonged studies are merited to verify the above conclusion.

AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.

This study is to evaluate the role of TLR-4 in lower laminar shear stress-induced interleukin-8 gene transcription activation in vascular endothelial cells by using gene mutation and transfection techniques. RT-PCR, Northern hybridization and immunocytochemical fluorescent staining showed that TLR-4 was expressed in human umbilical vein endothelial cells(HUVEC). When stimulated with 4.2 dyne/cm2 shear stress for 1 hour, an increase of TLR-4 mRNA expression was observed in HUVECs detected by RT-PCR and Northern hybridization. The intracellular domain deletion mutant TLR-4 cDNA (lacking the 155 COOH terminal amino acids of the wild type (TLR-4) and -102 -61 bp DNA sequence in 5'-flanking region of IL-8 gene (IL-8USCS) were isolated from endothelial cells by RT-PCR and PCR. These two DNA fragments were cloned into pcDNA3 and pEGFP1 respectively to construct TLR-4 dominant negative mutant pcDNA3-mTLR4 and IL-8 reporter gene pEGFP1-IL8USCS. ECV304 cells were transfected with the pEGFP1-IL8USCS or co-transfected with pEGFP1-IL8USCS and pcDNA3-mTLR4 by Dosper liposome transfectional reagent and selected by G418, then stimulated with 4.2 dyne/cm2 shear stress for 3 hours. Flow cytometric analysis showed that when exposed to 4.2 dyne/cm2 shear stress for 3 hours, there was a marked increase in the green fluorescent protein expression in pEGFP1-IL8USCS-transfected ECV304 cells. In contrast, there was almost no change in the green fluorescent protein expression in the cells co-transfected with pEGFP1-IL8USCS and pcDNA3-mTLR4 after the stimulation, suggesting the TLR-4 mutant depressed TLR-4 signaling. These experiments suggest that the inflammatory TLR-4/NF-kappa B signaling pathway would probably be involved in flow shear stress-induced IL-8 gene expression in human vascular endothelial cells.
Cells, Cultured ; Endothelium, Vascular ; cytology ; physiology ; Gene Expression Regulation ; Humans ; Interleukin-8 ; genetics ; Membrane Glycoproteins ; genetics ; physiology ; Mutation ; Receptors, Cell Surface ; genetics ; physiology ; Stress, Mechanical ; Toll-Like Receptor 4 ; Toll-Like Receptors ; Transcription, Genetic ; physiology ; Transfection ; Umbilical Veins ; cytology