PURPOSE: Numerous previous studies have reported inconsistent results about the differences between synchronous contralateral breast cancer (sCBC) and metachronous contralateral breast cancer (mCBC). This study aimed to compare the clinical characteristics and outcomes between sCBC and mCBC and determine predictive factors for the survival of sCBC and mCBC patients. METHODS: Using the Surveillance, Epidemiology, and End Results Program database, we identified sCBC or mCBC patients from 2000 to 2010. The Kaplan-Meier method and Cox proportional hazards regression analysis were used to analyze overall survival and breast cancer-specific survival (BCSS) rates of sCBCs and mCBCs, respectively. RESULTS: Overall, 14,057 sCBC (n = 8,139, 57.9%) and mCBC (n = 5,918, 42.1%) patients were included. The first tumors of sCBC were more likely to have higher stage and more lymph and distant metastases, whereas those of mCBC were more often infiltrating ductal carcinoma (IDC), had localized stage, were estrogen receptor (ER) and progesterone receptor (PR) negative, and had less axillary nodal involvement. The second tumors of mCBC tended to be IDC and have higher grade, adverse stage, ER and PR-negativity; and more axillary nodal involvement, compared to the second tumors of sCBC. mCBC patients had significantly favorable 5-year BCSS but worse long-term BCSS compared with sCBC patients. Moreover, subgroup analysis revealed no significant difference of BCSS between sCBC and mCBC among patients aged 18–60 years. Multivariate analysis indicated that age, grade, and stage of 2 tumors; surgery for second tumor; and ER status of the second tumor were independent prognostic factors for BCSS of contralateral breast cancer (CBC). CONCLUSION: The characteristics and outcomes of sCBCs and mCBCs were substantially different. sCBC and mCBC patients may have different prognosis, and the prognosis of CBC depends on the first and second tumors.
Age of Onset ; Breast Neoplasms ; Breast ; Carcinoma, Ductal ; Estrogens ; Humans ; Methods ; Multivariate Analysis ; Neoplasm Metastasis ; Prognosis ; Receptors, Progesterone ; Risk Factors ; SEER Program

OBJECTIVE: To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD). METHODS: Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family. RESULTS: Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband. CONCLUSION Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.
DNA Mutational Analysis ; Female ; Humans ; Mutation ; Pedigree ; Polycystic Kidney, Autosomal Dominant ; Pregnancy ; Prenatal Diagnosis ; TRPP Cation Channels