1.Effect of tritiated water on the immune system of zebrafish and mechanism analysis
Xiaofang GENG ; Chang LIU ; Yinyin YANG ; Yang ZHANG ; Le ZHAO ; Bingqing ZENG ; Chen WANG ; Pengyu LIN ; Yulong LIU
Chinese Journal of Radiological Health 2025;34(3):354-362
Objective To investigate the effect of tritiated water on the immune system of zebrafish and its potential molecular mechanism. Methods Zebrafish embryos (2.5 to 3 hours post-fertilization [hpf]) were exposed to 3.7 × 104 Bq/mL tritiated water (tritiated water group), and those exposed to E3 culture medium were used as the control group. The mortality rate, hatching rate, deformity rate, heart rate, body length, yolk sac area, neutrophil count in the tail, immune-related gene expression, and immune-related protein expression of zebrafish in the two groups were determined. Then transcriptome technology was used to further analyze the possible mechanism of tritiated water affecting the immune system of zebrafish. Results Compared with the control group, zebrafish at 72 hpf in the tritiated water group had no significant changes in the mortality rate, hatching rate, deformity rate, body length, and yolk sac area((t = 0.9045, 0.5000, 1.0000, 0.7238, 0.0337, P = 0.4169, 0.6433, 0.3739, 0.4785, 0.9735), but had significantly increased heart rate(t = 4.575,P = 0.002). At 4 days post-fertilization (dpf), the neutrophil count in the tail of zebrafish in the tritiated water group was significantly increased(t = 2.563,P = 0.0196), the mRNA expression of TNF-α was significantly decreased(t = 2.891, P = 0.045), the protein expression of nuclear factor-kappa B (NF-κB) was significantly increased(t = 3.848, P = 0.018), and the protein expression of NLRP3 was significantly decreased(t = 14.98, P = 0.001). At 7 dpf, the neutrophil count in the tail and the protein expression levels of NF-κB, NLRP3, and interleukin-1β were significantly decreased(t = 3.772, 7.048, 15.620, 4.423, P = 0.014, 0.002, 0.0001, 0.012). Transcriptome sequencing revealed that differentially expressed genes were mainly enriched in the “neutrophil activation” and “platelet activation pathways” at 4 dpf and in the “neutrophil apoptosis”, “ferroptosis”, and “necroptosis” pathways at 7 dpf. Conclusion Tritiated water exposure induces a temporally dynamic immune response in zebrafish, potentially affecting immune homeostasis by regulating neutrophil activation and apoptosis, as well as the expression of NF-κB and NLRP3.
2.Effect of pump infusion of esmketamine on emergence agitation induced by etomidate target-con-trolled infusion
Yufeng YANG ; Bingqing ZHAO ; Yi ZENG
The Journal of Clinical Anesthesiology 2024;40(2):165-169
Objective To investigate the effect of constant speed pump infusion of esmketamine on emergence agitation(EA)after target-controlled infusion of etomidate.Methods A total of 120 patients scheduled for middle ear tympanoplasty under target-controlled infusion of etomidate,61 males and 59 fe-males,aged 18-64 years,BMI 18-30 kg/m2,ASA physical status Ⅰ or Ⅱ,were randomly divided into two groups:the esmketamine group(group E)and the control group(group C),60 patients in each group.From the beginning of anesthesia induction to 30 minutes before the end of operation,esmketamine 0.2 ml·kg-1·h-1 in group E and saline injection 0.2 ml·kg-1·h-1 in group C were injected,respectively.The operation time,anesthesia time,awakening time,extubation time,and the duration in PACU were re-corded.The incidence of EA,the VAS pain scores when leaving PACU and 1 day after operation,the inci-dence and VAS score of nausea and vomiting 1 day after operation were evaluated.The anxiety and depres-sion scores of the two groups were evaluated before operation,1 day and 2 days after operation.Results The incidence of EA,VAS pain score when leaving PACU and 1 day after operation in group E were signifi-cantly lower than those in group C(P<0.05).There was no significant difference in operation time,anes-thesia time,awakening time,extubation time,the duration in PACU,incidence and VAS score of nausea and vomiting 1 day after operation,and the indexes of anxiety and depression at different time points be-tween the two groups.Conclusion Esmketamine pump infusion combined with etomidate target-controlled infusion can reduce emergence agitation and promote postoperative recovery.
3.Clinic information,pathological,and imaging characteristics in 2 058 surgical patients with lung cancer from a single center
Bingqing LONG ; Zeng XIONG ; Shulin LIU ; Yuanda CHENG ; Min LI ; Weihua LIAO
Journal of Central South University(Medical Sciences) 2024;49(2):247-255
Objective:Lung cancer is characterized by its high incidence and case fatality rate.Factors related to population composition and cancer prevention programme policy have an effect on the incidence and diagnosis of lung cancer.This study aims to provide scientific support for early diagnosis and treatment of lung cancer by investigating the clinic information,pathological,and imaging characteristics of surgical patients with lung cancer. Methods:The data of 2 058 patients,who underwent surgery for lung cancer in the Department of Thoracic Surgery of Xiangya Hospital of Central South University from 2016 to 2019,were retrospectively collected to analyze changes in clinic information,pathological,and imaging characteristics. Results:From 2016 to 2019,the number of patients per year was 280,376,524,and 878,respectively.Adenocarcinoma(68.1%)was the most common pathological type of surgical patients with lung cancer.From 2016 to 2019,the proportion of adenocarcinoma was increased from 55.5%to 74.1%.The proportion lung cancer patients in stage IA was increased from 38.9%to 62.3%,and the proportion of patients who underwent sublobar resection was increased from 1.8%to 8.6%.The proportion of lymph node sampling was increased in 2019.Compared with the rate in 2016,the detection rate of nodules with diameter≤1 cm detected by CT before surgery in 2019 was significantly improved(2.0%vs 18.2%),and the detection rate of nodules with diameter>3 cm was decreased(34.7%vs 18.3%).From 2016 to 2019,the proportion of lesions with pure ground-glass density and partial solid density detected by CT was increased from 2.0%and 16.6%to 20.0%and 37.3%,respectively.The proportion of solid density was decreased from 81.4%to 42.7%. Conclusion:The number of lung cancer surgery patients is rapidly increasing year by year,the proportion of CT-detected purely ground-glass density and partially solid density lesions are increasing,the proportion of patients with adenocarcinoma is rising,the proportion of early-stage lung cancer is increasing,smaller lung cancers are detected in earlier clinical stage leading to a more minimally invasive approach to the surgical methods.
4.Comparison of total intravenous anesthesia with alfentanil and remifentanil undergoing endoscopic sinus surgery
Yan LI ; Sansan JIA ; Bingqing ZHAO ; Yuanmei JI ; Li WANG ; Tao HE ; Xiaolan HE ; Yi ZENG
The Journal of Clinical Anesthesiology 2023;39(11):1137-1141
Objective To compare the effect of postoperative between total intravenous anesthesia(TIVA)use of alfentanil and remifentanil undergoing endoscopic sinus surgery.Methods A total of 130 and thirty patients scheduled for endoscopic sinus surgery,62 males and 68 females,aged 18-64 years,BMI 18-30 kg/m2,ASA physical status Ⅰ or Ⅱ,were randomly divided into two groups:alfentanil group(group A)and remifentanil group(group R).Midazolam 0.02 mg/kg,propofol target-controlled infusion(TCI)3 μg/ml,alfentanil 20 μg/kg,and rocuronium 0.6 mg/kg were injected intravenously in group A,and target-controlled infusion of propofol combined with alfentanil was used to maintain anesthesia.Midazo-lam 0.02 mg/kg,propofol TCI 3 μg/ml,remifentanil 1 μg/kg,and rocuronium 0.6 mg/kg were injected intravenously in group R,and target-controlled infusion of propofol combined with remifentanil was used to maintain anesthesia.The number of intraoperative hemodynamic adverse reactions such as hypertension,tachycardia,hypotension,bradycardia during operation,and pain degree at 30 minutes,60 minutes,24 hours after operation,extubation time,and rescue analgesia and adverse reactions such as nausea and vomi-ting,skin pruritus,respiratory depression within 24 hours after operation were recorded.Results Compared with group R,the incidence of intraoperative hypotension in group A was significantly lower(P<0.05),the incidence of painless in group A 30 and 60 minutes after operation was significantly higher(P<0.05),the incidence of mild and moderate pain was significantly decreased(P<0.05),and the recovery time was significantly prolonged(P<0.05).There was no significant difference in rescue analgesia within 24 hours after operation.There were no significant differences in the incidence of postoperative nausea and vomiting,postoperative skin pruritus,and respiratory depression between the two groups.Conclusion In endoscopic sinus surgery,the effect of total intravenous anesthesia with alfentanil on postoperative analgesia is better than that of remifentanil,and the incidence of perioperative and postoperative adverse reactions in alfentanil is lower than that of remifentanil,while the recovery time of alfentanil is slightly longer than that of remifentanil.
5.Role of active screening in the diagnosis and treatment of early lung cancer and suggestions for health management
Zeng XIONG ; Bingqing LONG ; Shaohui LIU ; Shulin LIU ; Yuanda CHENG ; Bihan OUYANG ; Baoxiang WANG ; Xuewei ZHANG ; Weihua LIAO
Chinese Journal of Health Management 2023;17(3):188-193
Objective:To explore the role of active screening in the diagnosis and treatment of early lung cancer, and give health management recommendations.Methods:A retrospective study was conducted to collect lung cancer patients who had complete population sociology, clinical information, pathology and imaging characteristics in the Thoracic Surgery in Xiangya Hospital of Central South University from 2016 to 2019. According to different diagnostic modes, they were divided into an active screening group (1082 cases) and a passive case finding group (974 cases), to analyze their differences in demographic sociological, clinical information, pathology and imaging characteristics, and to discuss the key points of population management in the active screening group.Results:From 2016 to 2019, the proportion of lung cancer patients in the active screening group increased from 36.1% to 54.2%, and the proportion of patients found to have lung cancer by CT examination in the active screening group increased from 82.2% to 96.8%. Compared with the passive case finding group, the active screening group had a higher proportion of women, non-smokers, patients with precursor glandular lesions and adenocarcinoma, patients in stage 0 and stage I, patients with lesion diameter (d)≤1 cm and 1
6.The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort
Bingqing ZHANG ; Weigang FANG ; Yun ZHANG ; Shufen LIU ; Xuejun ZENG
Chinese Journal of Internal Medicine 2017;56(11):833-838
Objective To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia .Method A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing .The enrollment criteria were faculty member of the hospital with signed consent .The exclusion criteria were tumor , previous renal diseases , renal function damage , pregnancy , currently taking medicines that could increase or decrease serum uric acid level , and those who had gout.Males with serum uric acid >416.4 μmol/L and females with serum uric acid >359.6 μmol/L were enrolled as hyperuricemia group .Subjects with normal serum uric acid were randomly enrolled at 1:2 ratio after matching for gender , age, renal function and body mass index .Rs2231142( C>A) was assayed by amplification refractory mutation system polymerase chain reaction , with common forward primer:5′GGCTTTGCAGACATCTATGG 3′, C specific reverse primer:5′CGAAGAGCTGCTGAGAAATG 3′, and A specific reverse primer:5′CGAAGAGCTGCTGAGAAATT 3′.Association between rs 2231142 and hyperuricemia was analyzed in the general study group , as well as different gender and age groups .Results A total of 198 subjects with hyperuricemia and 370 controls were enrolled .The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001).After adjustment for hypertension, hyperglycemia and dyslipidemia , the OR was 2.99 (95%CI 1.94 -4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female.In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female.While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females.Interaction study between gender and rs 2231142 did not reach significant level in both the gender group and two age groups . Conclusion Single nucleotide polymorphism rs 2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort .The ORs are higher in male than those in female , especially in those less than 55 years old .

Result Analysis
Print
Save
E-mail