2.Inhibition of anti-PDGF on proliferation of cultured human retinal pigment epithelial cells in vitro
Yazhen WU ; Hui QI ; Bin FAN ; Huiling GUO ; Fei LI
Journal of Jilin University(Medicine Edition) 2006;0(06):-
Objective To study the inhibition of anti-PDGF on proliferation of cultured human retinal pigment epithelial cells(hRPE) in vitro.Methods hRPE were cultivated and were exposed to different concentrations of anti-PDGF(0,1?10-6,5?10-6,1?10-5,5?10-5 and 1?10-4 mg?L-1) respectively .Growth curves were measured with cell counting and the vitalities of cells were examined by percentage of vital cells and total cells.Using MTT staining colorimetric to measure the inhibitory rate.The changes of cell cycle of hRPE were collected and their growth were detected with FCM analysis and the morphological changes of cells were observed by light microscope and electron microscope.Results Anti-PDGF of 1?10-6mg?L-1 stimulated hRPE proliferation slightly.AntiPDGF at dosages ranging from 5?10-6mg?L-1 to 1?10-4mg?L-1 inhibited cell proliferation effectively in a dose-dependent and time-dependent manner(P
4.Rat ?-defensin rBD-1 gene expresses constitutively in skin and kidney
Ning HUANG ; Qi WU ; Bin TANG ; Xinnian CHENG ; Boyao WANG
Chinese Journal of Pathophysiology 1986;0(01):-
AIM: To determine tissue distribution of rat ?-defensin rBD-1 gene expression.METHODS: Total RNA was isolated from 10 kinds of rat tissues. RT-PCR were performed with primers (R 1 5′→3′ ACTCTGGACCCTGACTTCACCG; R 2 5′→3′ CCCTTGCTTGTCCTTTATGTCC). The RT-PCR products around 272 bp in size were cloned into pGEM-T easy vector and the recombinant clones were analyzed by digestion with restriction endonucleases and DNA sequencing.RESULTS: Rat ?-defensin rBD-1 transcripts were found in the kidney and skin, whereas its mRNA was not detected in trachea, uterus, bladder, small intestine, spleen, skeletal muscle, bone marrow and parotid. Sequence analysis confirmed that the RT-PCR product is rBD-1 cDNA. CONCLUSION: These data suggested that ?-defensin rBD-1 may participate not only in the kidney but also in the skin natural defense against infections.
5.The applied research on the diagnosis of computed tomography for the metastasis of right recurrent nerve nodes in squamous cell carcinoma of thoracic esophagus
Song ZHAO ; Bin WU ; Yang YANG ; Yu QI ; Chunyang ZHANG ; Donglei LIU ; Kai WU
Chinese Journal of Thoracic and Cardiovascular Surgery 2014;30(10):615-617
Objective Study the diagnostic value of CT to assess the transfer of right recurrent nerve nodes(RRNN) on the thoracic esophageal squamous carcinoma,so as to provide reference for thoracic segment esophageal surgery way.Methods A retrospective analysis from January 2011 to February 2014 in the first affiliated hospital of zhengzhou university at the records of 132 cases of thoracic segment esophageal thoracic surgery with preoperative CT image data,recorded each patient's right recurrent nerve nodes in the largest length to diameter and the average CT number,and compared with postoperative pathologic results.Results With the ROC curve analysis,considering transfer when the length of RRNN' s diameter 8.5 mm or more in CT,the area under the curve is 0.911,the sensitivity is 85.7%,specificity is 78.8%.Considering transfer when the RRNN average CT number acuity 32.50 HU,the area under the curve is 0.815,the sensitivity is 85.7%,specificity is 76.9%.Whether RRNN transfer has significant correlation(P < 0.05) with the length of tumor,tumor location and whether lymph node of other station transfer,doesn' t have significant correlation (P > 0.05)with patients'age,sex,tumor differentiation degree and the T stage.Conclusion When the RRNN length to diameter 8.5 mm or RRNN average CT numberr acuity 32.50 HU,right recurrent nerve nodes should be considered lymph node metastasis,and choose chest conclusion laparoscopic radical prostatectomy.The upper thoracic portion esophageal tumor's length is 5 cm or more,or clinical suspected lymph node metastasis of other station is the risk factor for metastasis of RRNN.
6.Role of oxygen free radicals in hypertension and cardiovascular remodeling of nitric oxide-deficient rats
Qi CHEN ; Yanqing WU ; Xiaoshu CHENG ; Bin ZOU ; Qinghua WU ; Hai SU ; Juxiang LI
Chinese Journal of Tissue Engineering Research 2006;10(44):198-201
BACKGROUND: Our previous study showed that the activation of local renin-angiotensin system in heart and vessels contributed to hypertension and cardiovascular remodeling. However, whether oxygen free radical plays an important role in this process is still unclear. OBJECTIVE: To investigate the interventional effects of Ebselen, a kind of anti-oxidative drug, on rats administered by Nw-Nitro-L-arginine methyl easter (L-NAME) (L-NAME), inhibitor of nitric oxide synthase (NOS) for a long term, and probe into the role of oxygen free radicals (OFR) in hyper- tension and cardiovascular remodeling of NO-deficient rats. DESIGN: A randomized grouping and controlled animal trial. SETTING: Department of Cardiology, the Second Affiliated Hospital of Nanchang University, Institute of Cardiology, Nanchang University. MATERIALS: The experiment was completed from January 2002 to March 2003 at the Animal Experimental Lab, Institute of Cardiology, Nanchang University and the Key Molecular Medical Lab of Jiangxi Province. Twenty-four Wistar rats were divided to three groups according to the random number table method: normal control group (n=8), L-NAME group (n=8), L-NAME + Ebselen group (n=8). METHODS: ①Normal control group: The rats could eat and drink routinely, and they were administrated by skim milk ball (net weigh = 4 g) before feed every night. ② L-NAME group: The rats received L-NAME in the dose of 50 mg/kg mixed in one skim milk ball everyday before feed every night. ③ L-NAME + Ebselen group: The rats were admin istered by one skim milk ball (net weigh = 2 g) mixed with L-NAME (50 mg/kg) and one skim milk ball (net weigh = 2 g) mixed with ebselen (30 mg/kg). The systolic blood pressure (SBP) was detected before LNAME was given and at the ends of the 1st, 2nd, 4th,6th and 8th weeks respectively. The rats were killed under anesthesia at the end of the 8th week, the plasma and homogenate of myocardium of apex were taken to detect the biochemical indexes, the other heart tissues were used for the histological detections. MAIN OUTCOME MEASURE: ① Dynamic changes of blood pressure were observed. The levels of NO and malondialdehyde (MDA), activities of angiotensin-converting enzyme (ACE) and superoxide dismutase (SOD) in plasma and myocardium of apex were measured. The production of superoxide anion and the levels of angiotensin Ⅱ type 1 receptor (AT1R) protein expression in myocardium of apex were determined. ③ The pathomor- phological indexes were determined. RESULTS: All the 24 rats were involved in the analysis of results without deletion. ① SBP: At the ends of the 1st, 2nd, 4th 6th and 8th weeks, SBP elevated gradually in the L-NAME group, which were significantly higher than those in the control group at the same time (P < 0.05-0.01). At the end of the 8th week, the SBP was significantly lower in the L- NAME + Ebselen group than in the L-NAME group (P < 0.05). ② Bio chemical indexes in plasma and homogenate of myocardium of apex: The NO level and SOD activity in myocardial tissue were significantly lower in the L-NAME group than in the normal control group (P < 0.05-0.01), but significantly higher in the L-NAME + Ebselen group than in the L- NAME group (P < 0.05-0.01). The production of superoxide anion, ACE activity and level of AT1R expression were all significantly higher in the L-NAME group than in the normal control group (P < 0.05), but signifi- cantly lower in the L-NAME + Ebselen group than in the L-NAME group. ③ Pathomorphological indexes: The ratio of cardiac mass to body mass, thickness of left ventricle and ratio of thickness to lumen diameter of small artery were all significantly higher in the L-NAME group and L- NAME + Ebselen group than in the normal control group (P < 0.05-0.01), and the thickness of left ventricle and ratio of thickness to lumen diameter of small artery were significantly lower in the L-NAME + Ebselen group than in the L-NAME group (P < 0.05) CONCLUSION: Ebselen, an anti-oxidative drug, enable to attenuate the development of hypertension and cardiovascular remodeling in NO-deficient rats. By activating renin-angiotensin system (RAS), OFR may accelerate the formation of hypertension and cardiovascular remodeling, and the increased production of OFR may contribute to the development of cardiovascular remodeling. It is indicated that RAS may play an important role in the development of hypertension and cardiovascular remodeling induced by NO-deficiency
7.Effect of allitridum on remodeling of the transient outward potassium current of ventricular myocytes of spontaneously hypertensive rats.
Qing DAN ; Ying ZHAO ; Zhi-juan WU ; Chao ZHU ; Li LIU ; Bin XU ; Yu-qi LIU ; Qi CHEN ; Yang LI
Acta Pharmaceutica Sinica 2015;50(1):39-44
We aimed to study the effect of allitridum (All) on the transient outward potassium current (Ito) of ventricular myocytes of spontaneously hypertensive rats (SHR). Totally 30 male SHRs were randomly divided into three groups: low-dose All group (7.5 mg·kg(-1)), high-dose All group (15.0 mg·kg(-1)) and normal saline group. The other 10 sex and age matched Wistar-kyoto rats (WKY) were also taken as control group (WKY group). All animals received i.p. administration for 8 weeks. The dual enzymatic method was used to separate single ventricular myocyte from animals. Patch-clamp technique was used to record Ito and analyze the effect of All on the current. It was shown that the left ventricular hypertrophy of SHR was reversed significantly by All. Furthermore, the density of Ito was recovered in both high and low dose All groups. The peak current densities of Ito were enhanced from 18.23±3.64 to 25.17±2.86 pA/pF (P<0.01) and 36.47±5.42 pA/pF (P<0.01) at +50 mV by All 7.5 mg·kg(-1) and 15.0 mg·kg(-1), respectively, which was not significantly different with WKY group. The effect was associated with positive shift of the steady-state, close-state inactivation, and shortened recovery from inactivation of Ito. It is concluded that All decreases the remodeling of Ito of ventricular hypertrophic myocytes of SHR.
Allyl Compounds
;
pharmacology
;
Animals
;
Hypertrophy, Left Ventricular
;
drug therapy
;
Male
;
Myocytes, Cardiac
;
cytology
;
drug effects
;
Patch-Clamp Techniques
;
Potassium Channels
;
metabolism
;
Rats
;
Rats, Inbred SHR
;
Rats, Inbred WKY
;
Sulfides
;
pharmacology
8.Inactivation of the Rho-ROCK signaling pathway to promote neurologic recovery after spinal cord injuries in rats.
Bin-qi WU ; Zheng-gang BI ; Quan QI
Chinese Medical Journal 2013;126(19):3723-3727
BACKGROUNDAfter injury, axonal regeneration of the adult central nervous system (CNS) is inhibited by myelin-derived growth-suppressing proteins. These axonal growth inhibitory proteins are mediated via activation of Rho, a small GTP-binding protein. The activated form of Rho, which is bound to GTP, is the direct activator of Rho kinase (ROCK) through serial downstream effector proteins to inhibit axonal regeneration. The objective of this study was to observe the therapeutic effect of inactivation of the Rho-ROCK signaling pathway to promote neurologic recovery after spinal cord injuries in rats.
METHODSOne hundred and twenty adult female Sprague-Dawley rats were randomly divided into three groups. Laminectomies alone were conducted in 40 rats in the sham group. Laminectomies and spinal cord transections were performed in 40 rats in the control group (treated with normal saline administered intraperitoneally). Laminectomies and spinal cord transections were performed in 40 rats in the fasudil-treated group (treated with fasudil administered intraperitoneally). Neurologic recovery was evaluated before surgery and 3 days, and 1, 2, 3, and 4 weeks after surgery using the Basso-Beattie-Bresnahan (BBB) scale of hind limb movement. At the same time, the expression of RhoA mRNA was determined with RT-PCR. Histopathologic examinations and immunofluorescence staining of NF were performed 1 month after surgery.
RESULTSCompared with the control group, the BBB scores of the fasudil-treated group were significantly increased and the expression of RhoA mRNA was significantly decreased. In the fasudil-treated group, a large number of NF-positive regenerating fibers was observed; some fibers crossed the slit of the lesion.
CONCLUSIONInactivation of the Rho-ROCK signaling pathway promotes CNS axonal regeneration and neurologic recovery after spinal cord injuries in rats.
Animals ; Female ; Fluorescent Antibody Technique ; Nerve Regeneration ; Rats ; Rats, Sprague-Dawley ; Signal Transduction ; physiology ; Spinal Cord Injuries ; pathology ; physiopathology ; psychology ; therapy ; rho-Associated Kinases ; antagonists & inhibitors ; physiology ; rhoA GTP-Binding Protein ; antagonists & inhibitors ; physiology
9.Changes of renin-angiotensin-aldosterone system in workers exposed to noise
WU Qi feng LI Qi ping LI Cong LIANG Wei hui LI Bin LI Wan li DENG Xiao feng
China Occupational Medicine 2022;49(06):640-644
Objective - ( )- ( )
To observe the effects of renin angiotensin Ang aldosterone system RAAS in workers exposed to
Methods - -
occupational noise. Forty five workers with suspected occupational noise induced deafness were selected as noise
, ,
exposure group using convenient sampling method. According to their tinnitus symptom noise exposure intensity and work age
- , ,
they were divided into no tinnitus and tinnitus subgroups <90 dB and ≥90 dB subgroups work years <10 years and ≥10 years
subgroups. Another 45 workers with no occupational noise exposure history were selected as control group. The levels of plasma
( ), , ,
renin activity PRA AngⅠ AngⅡ and aldosterone of the two groups were detected and the aldosterone to renin activity
Results
ratio was calculated. The diastolic blood pressure of the noise exposure group was higher than that of the control group
[( )vs( ) ,P ] ,
80±7 76±8 mmHg <0.05 . However there was no significant difference in systolic blood pressure between the two
(P ) ( :
groups >0.05 . The level of plasma AngⅡ in the noise exposure group was higher than that in the control group median
vs ,P ) ( P )
100.98 65.43 μg/L <0.05 . There was no statistical significance in other indexes between the two groups all >0.05 . The
( :
plasma AngⅡ level in < 90 dB subgroup in the noise exposure group was higher than that of the control group median 123.16
vs ,P )
65.43 μg/L <0.05 . There was no statistical significance in other indexes among the two subgroups of tinnitus symptom or
( P )
work age in the noise exposure group and the control group all >0.05 . There were no significant differences in the abnormal
, ( P )
rates of PRA AngⅡ and aldosterone in plasma between the noise exposure group and the control group all >0.05 .
Conclusion
Occupational noise exposure may affect RAAS and lead to increased plasma AngⅡ levels in the workers.
-
Tinnitus and work age may not affect RAAS in occupational noise exposure workers.
10.Changes of renin-angiotensin-aldosterone system in workers exposed to noise
WU Qi feng LI Qi ping LI Cong LIANG Wei hui LI Bin LI Wan li DENG Xiao feng
China Occupational Medicine 2022;49(06):640-644
Objective - ( )- ( )
To observe the effects of renin angiotensin Ang aldosterone system RAAS in workers exposed to
Methods - -
occupational noise. Forty five workers with suspected occupational noise induced deafness were selected as noise
, ,
exposure group using convenient sampling method. According to their tinnitus symptom noise exposure intensity and work age
- , ,
they were divided into no tinnitus and tinnitus subgroups <90 dB and ≥90 dB subgroups work years <10 years and ≥10 years
subgroups. Another 45 workers with no occupational noise exposure history were selected as control group. The levels of plasma
( ), , ,
renin activity PRA AngⅠ AngⅡ and aldosterone of the two groups were detected and the aldosterone to renin activity
Results
ratio was calculated. The diastolic blood pressure of the noise exposure group was higher than that of the control group
[( )vs( ) ,P ] ,
80±7 76±8 mmHg <0.05 . However there was no significant difference in systolic blood pressure between the two
(P ) ( :
groups >0.05 . The level of plasma AngⅡ in the noise exposure group was higher than that in the control group median
vs ,P ) ( P )
100.98 65.43 μg/L <0.05 . There was no statistical significance in other indexes between the two groups all >0.05 . The
( :
plasma AngⅡ level in < 90 dB subgroup in the noise exposure group was higher than that of the control group median 123.16
vs ,P )
65.43 μg/L <0.05 . There was no statistical significance in other indexes among the two subgroups of tinnitus symptom or
( P )
work age in the noise exposure group and the control group all >0.05 . There were no significant differences in the abnormal
, ( P )
rates of PRA AngⅡ and aldosterone in plasma between the noise exposure group and the control group all >0.05 .
Conclusion
Occupational noise exposure may affect RAAS and lead to increased plasma AngⅡ levels in the workers.
-
Tinnitus and work age may not affect RAAS in occupational noise exposure workers.