1.Prediction of pathological complete response to neoadjuvant chemoradiotherapy in locally advanced rectal cancer using contrast-enhanced ultrasound radiomics
Qiong QIN ; Yuquan WU ; Rong WEN ; Xiumei BAI ; Ruizhi GAO ; Yadan LIN ; Jiayi LYU ; Yun HE ; Hong YANG
Chinese Journal of Ultrasonography 2024;33(1):63-70
Objective:To evaluate the diagnostic performance of radiomics model based on contrast-enhanced ultrasound(CEUS) in predicting pathological complete response(pCR) after neoadjuvant chemoradiotherapy(nCRT) in patients with locally advanced rectal cancer(LARC).Methods:One hundred and six patients with LARC who underwent total mesorectal excision after nCRT between April 2018 and April 2023 in the First Affiliated Hospital of Guangxi Medical University were retrospectively included, the patients were randomly divided into a training set of 63(14 pCR patients) and a validation set of 43(12 pCR patients) in a 6∶4 ratios. Radiomics features were extracted from the tumors′ region of interest of CEUS images based on PyRadiomics. Intra-class correlation coefficient(ICC), Mann-Whitney U test, and least absolute shrinkage and selection operator(LASSO) algorithms were used to reduce features dimension. Finally, 7 radiomics features relevanted to pCR were selected to construct an ultrasomics model using elastic network regression, based on the R language. A combined model was constructed by jointing clinical feature. The performance of the models was assessed with the area under the ROC curve(AUC). Results:The AUC of the ultrasomics model and the combined model was 0.695(95% CI=0.532-0.859) and 0.726(95% CI=0.584-0.868) respectively in the training set. The AUC of the ultrasomics model and the combined model was 0.763(95% CI=0.625-0.902) and 0.790(95% CI=0.653-0.928) respectively in the validation set. Both univariate and multivariate Logistic regression analyses showed that CA199( P<0.05) and ultrasomics score( P<0.001) could be an independent predictor of pCR after nCRT in patients with LARC. Conclusions:The CEUS-based radiomics scores has certain predictive value for whether LARC patients achieve pCR after nCRT, and may provide a non-invasive imaging biomarker for predicting LARC patients achieve pCR after nCRT.
2.The Association between GLP-1 Receptor-Based Agonists and the Incidence of Asthma in Patients with Type 2 Diabetes and/or Obesity:A Meta-Analysis
Zhang MENGQING ; Lin CHU ; Cai XIAOLING ; Jiao RUOYANG ; Bai SHUZHEN ; Li ZONGLIN ; Hu SUIYUAN ; Lyu FANG ; Yang WENJIA ; Ji LINONG
Biomedical and Environmental Sciences 2024;37(6):607-616
Objective Recent studies have indicated potential anti-inflammatory effects of glucagon-like peptide-1 receptor agonists(GLP-1RAs)on asthma,which is often comorbid with type 2 diabetes mellitus(T2DM)and obesity.Therefore,we conducted a meta-analysis to assess the association between the administration of glucagon-like peptide-1(GLP-1)receptor-based agonists and the incidence of asthma in patients with T2DM and/or obesity. Methods PubMed,Web of Science,Embase,the Cochrane Central Register of Controlled Trials,and Clinicaltrial.gov were systematically searched from inception to July 2023.Randomized controlled trials(RCTs)of GLP-1 receptor-based agonists(GLP-1RA,GLP-1 based dual and triple receptor agonist)with reports of asthma events were included.Outcomes were computed as risk ratios(RR)using a fixed-effects model. Results Overall,39 RCTs with a total of 85,755 participants were included.Compared to non-GLP-1 receptor-based agonist users,a trend of reduced risk of asthma was observed in patients with T2DM or obesity using GLP-1 receptor-based agonist treatments,although the difference was not statistically significant[RR=0.91,95%confidence interval(CI):0.68 to 1.24].Further Subgroup analyses indicated that the use of light-molecular-weight GLP-1RAs might be associated with a reduced the risk of asthma when compared with non-users(RR=0.65,95%CI:0.43 to 0.99,P=0.043).We also performed sensitivity analyses for participant characteristics,study design,drug structure,duration of action,and drug subtypes.However,no significant associations were observed. Conclusion Compared with non-users,a modest reduction in the incidence of asthma was observed in patients with T2DM or obesity using GLP-1 receptor-based agonist treatments.Further investigations are warranted to assess the association between GLP-1 receptor-based agonists and the risk of asthma.
3.Application of nasal endoscopic Draf Ⅱ-Ⅲ frontal sinus surgery in recurrent frontal sinus infection and sinus formation after craniocerebral trauma
Cao LYU ; Xiaobin HUANG ; Jie CHEN ; Zhong LAN ; Yi TU ; Xiaohong YANG ; Zhong BAI
Chinese Archives of Otolaryngology-Head and Neck Surgery 2024;31(4):248-250
OBJECTIVE To investigate the application of endoscopic Draf Ⅱ-Ⅲ frontal sinus surgery in the treatment of recurrent frontal sinus infection and fistula formation after craniocerebral trauma.METHODS There were 8 cases of recurrent frontal sinus infection after craniocerebral trauma,the main manifestations were headache,recurrent frontal infection,discharge of pus,fistula formation.The average onset time was 43.25 months.The patients underwent DRAF Ⅱ-Ⅲ frontal sinus surgery under nasal endoscopy,including Draf Ⅱa 2,Draf Ⅱb 5,and Draf Ⅲ1,respectively.During the operation,the frontal sinus ostium was expanded.It was found that bone wax blocked the frontal sinus ostium in the frontal sinus.The bone wax was removed,and the frontal sinus drainage was smooth.No facial incision was made in all patients.RESULTS There were 8 patients with frontal infection who were cured after surgery.No cerebrospinal fluid rhinorrhea or intracranial infection occurred during or after operation.After discharge,the outpatient follow-up review was conducted in 1,3,6,and 12 months.It was found that the frontal sinus remained unobstructed.The frontal sinus did not become infected again,and the fistula gradually healed.CONCLUSION Draf Ⅱ-Ⅲ frontal sinus surgery under nasal endoscopy is an effective way to treat recurrent frontal sinus infection and fistula formation after craniocerebral trauma.
4.Rapid Determination of 32 Kinds of Veterinary Drug Residues in Eggs Using Modified QuEChERS Based on Reduced Graphene Oxide-coated Melamine Sponge by Ultra-High Liquid Chromatography-Tandem Mass Spectrometry
Xu XU ; Jia LYU ; Lan-Rui YANG ; Zhu-Chen HOU ; Bao-Cheng JI ; Yan-Hong BAI
Chinese Journal of Analytical Chemistry 2024;52(1):121-129,中插38-中插43
A rapid analytical method for simultaneous determination of 32 kinds of multi-residue veterinary drugs in eggs was developed using a modified QuEChERS technique based on a reduced graphene oxide-coated melamine sponge(r-GO@MeS)by ultra-high performance liquid chromatography-tandem mass spectrometry(UPLC-MS/MS).The influences of graphene oxide(GO)concentrations,sponge dosages,and purification modes on drug recoveries were investigated during the purification process.The optimal purification conditions involved using a GO concentration of 0.5 mg/mL,a sponge dosage of 6.0 cm3/mL,and a dynamic purification mode of 5 extrusion cycles.Separation was achieved using an Agilent Eclipse Plus C18 RRHD column(100 mm×2.1 mm,1.8 μm),and quantitative analysis was performed by the external standard method using an electrospray ionization source(ESI)in multiple reaction monitoring(MRM)mode.The results showed that all 32 kinds of veterinary drugs exhibited good linear correlation with coefficients greater than 0.999,and matrix effects(MEs)ranging from?7.8%to 18.9%.The limits of detection(LODs)and quantification(LOQs)ranged from 0.2 to 10.2 μg/kg and from 0.6 to 28.0 μg/kg,respectively.The recoveries for the three spiked levels were in the range of 66.5%?117.5%,with intra-day and inter-day precision(Relative standard deviation)below 13.3%and 16.3%,respectively.The synthetic r-GO@MeS exhibited efficient matrix purification without the need of high-speed centrifugation or strong magnetic field assistance.This significantly shorted the sample pretreatment time and improved the convenience of the matrix purification process.Combined with UPLC-MS/MS,the method was suitable for the rapid determination of multi-residue veterinary drugs in eggs.
5.A Precise and Portable Detection System for Infectious Pathogens Based on CRISPR/Cas Technology
Yi-Chen LIU ; Ru-Jian ZHAO ; Bai-Yang LYU ; De-Feng SONG ; Yi-Dan TANG ; Yan-Fang JIANG ; Bing-Ling LI
Chinese Journal of Analytical Chemistry 2024;52(2):187-197
Nucleic acid-based molecular diagnostic methods are considered the gold standard for detecting infectious pathogens.However,when applied to portable or on-site rapid diagnostics,they still face various limitations and challenges,such as poor specificity,cumbersome operation,and portability difficulties.The CRISPR(Clustered regularly interspaced short palindromic repeats)/CRISPR-associated protein(Cas)-fluorescence detection method holds the potential to significantly enhance the specificity and signal-to-noise ratio of nucleic acid detection.In this study,we developed a portable grayscale reader detection system based on loop-mediated isothermal amplification(LAMP)-CRISPR/Cas.On one hand,in the presence of CRISPR RNA(crRNA),the CRISPR/Cas12a system was employed to achieve precise fluorescent detection of self-designed LAMP amplification reactions for influenza A and influenza B viruses.This further validated the high selectivity and versatility of the CRISPR/Cas system.On the other hand,the accompanying independently developed portable grayscale reader allowed for low-cost collection of fluorescence signals and high-reliability visual interpretation.At the end of the detection process,it directly provided positive or negative results.Practical sample analyses using this detection system have verified its reliability and utility,demonstrating that this system can achieve highly sensitive and highly specific portable analysis of influenza viruses.
6.The Uptake and Distribution Evidence of Nano-and Microplastics in vivo after a Single High Dose of Oral Exposure
Tao HONG ; Wei SUN ; Yuan DENG ; Da Jian LYU ; Hong Cui JIN ; Long Ying BAI ; Jun NA ; Rui ZHANG ; Yuan GAO ; Wei Guo PAN ; Sen Zuo YANG ; Jun Ling YAN
Biomedical and Environmental Sciences 2024;37(1):31-41
Objective Tissue uptake and distribution of nano-/microplastics was studied at a single high dose by gavage in vivo.Methods Fluorescent microspheres (100 nm, 3 μm, and 10 μm) were given once at a dose of 200 mg/(kg·body weight). The fluorescence intensity (FI) in observed organs was measured using the IVIS Spectrum at 0.5, 1, 2, and 4 h after administration. Histopathology was performed to corroborate these findings.Results In the 100 nm group, the FI of the stomach and small intestine were highest at 0.5 h, and the FI of the large intestine, excrement, lung, kidney, liver, and skeletal muscles were highest at 4 h compared with the control group (P < 0.05). In the 3 μm group, the FI only increased in the lung at 2 h (P < 0.05). In the 10 μm group, the FI increased in the large intestine and excrement at 2 h, and in the kidney at 4 h (P < 0.05). The presence of nano-/microplastics in tissues was further verified by histopathology. The peak time of nanoplastic absorption in blood was confirmed.Conclusion Nanoplastics translocated rapidly to observed organs/tissues through blood circulation;however, only small amounts of MPs could penetrate the organs.
7.The feasibility and safety of robot-assisted laparoscopic retroperitoneal tumor resection in prone position
Haonan CHEN ; Xiao YANG ; Rongjie BAI ; Juntao ZHUANG ; Lingkai CAI ; Peikun LIU ; Qiang CAO ; Pengchao LI ; Qiang LYU
Chinese Journal of Urology 2024;45(8):577-581
Objective:To discuss the feasibility and safety of robot-assisted laparoscopic retroperitoneal tumor resection in prone position.Methods:From August 2023 to January 2024, a total of eight patients with retroperitoneal tumors from the First Affiliated Hospital of Nanjing Medical University were retrospectively analyzed, including two males and six females. The average age was (47.4±12.5) years, average BMI was (24.4±3.5) kg/m 2 and median ASA grade was 2(2, 3). Retroperitoneal tumors were identified preoperatively through CT or MRI. The imaging revealed 4 cases of adrenal tumors located on the left side, 2 on the right side, and 2 non-adrenal tumors situated on the left side. The preoperative diagnoses included 2 cases of non-functional adrenal tumors, 2 cases of pheochromocytoma, 1 case of Cushing’s syndrome, 1 case of metastatic renal cell carcinoma, and 2 cases of non-adrenal tumors. Robot-assisted laparoscopic retroperitoneal tumor resection was performed with all patients in prone position. The inferior margin of the fourth lumbar vertebra (L4) was determined by the line connecting the highest points of the iliac crests bilaterally. Subsequently, the inferior margins of the L1-L3 vertebrae were sequentially identified. The surgical field was then divided into three equal segments, utilizing the posterior midline of the spine and the midaxillary line as boundaries. The medial division was situated approximately at the lateral border of the vertical spinal muscles, while the lateral division was placed near the tip of the 12th rib. A longitudinal incision of approximately 3 cm in length was created within the lateral division between L2 and L3 for the insertion of a camera trocar. The extraperitoneal space was subsequently dilated using a self-made balloon, and two 8 mm trocars were placed as operative ports along the medial division and the midaxillary line, respectively, under finger guidance. Assistance trocars, one or two 12 mm in diameter, were introduced above the level of the iliac crest. During the operation, the extraperitoneal adipose tissue was removed and the Gerota's fascia was opened. For non-adrenal retroperitoneal tumours, the major blood vessels around the tumour were suspended and fixed, by titanium clips or Hem-o-lok clips to dissect the small arteries and veins, and the tumour was carefully isolated and completely resected. For adrenal tumours, the fat capsule around the upper pole of the kidney were removed, the adrenal gland was exposed, and then the tumour was removed completely along its capsule. If total adrenalectomy is performed, the central adrenal vein was clamped and dissected. The periphery of the adrenal gland was gradually dissected until the adrenal gland was completely removed.The perioperative data, including patient positioning time, trocar placement time, operation time, intraoperative blood loss, postoperative complications, postoperative hospital stay, and postoperative drainage tube removal time, as well as recurrence and metastasis, were recorded.Two patients underwent partial nephrectomy due to renal tumor, and only the time for retroperitoneal tumor resection was included in calculating operation time. Results:All 8 surgeries were successfully completed without dramatic blood pressure fluctuations.There was no conversion to open surgery or abdominal organ injury. The patient positioning time was (5.1±0.4) minutes, trocar placement time was (16.6±1.3) minutes, operation time was (28.8±13.8) minutes, intraoperative blood loss was (65.0±28.7) ml, postoperative hospital stay was (3.6±0.9) days, and drainage tube removal time was (2.8±1.0) days. No intraoperative or postoperative blood transfusions were required. Postoperatively diagnosed pathologies included: 2 cases of adrenal pheochromocytoma, 2 cases of adrenal sebaceous adenoma, 2 cases of retroperitoneal schwannoma, 1 case of adrenal myelolipoma, and 1 case of adrenal metastatic renal cell carcinoma. The average tumor size for all patients was (4.3±1.5) cm. After a follow-up of 2.0-7.2 months, there were no recorded postoperative complications, including haemorrhage, infections, acute hypotension, or adrenocortical insufficiency. Additionally, no evidence of tumor recurrence or metastasis was observed up during foolow-up.Conclusions:Robot-assisted laparoscopic retroperitoneal tumor resection in prone position could be a safe and feasible surgical approach with short operative time, low bleeding, and fast postoperative recovery.
8.Preparation and application of PRRSV MS2 armored virus-like particles qualityas control products
Jiamin HE ; Xuanfei PANG ; Lyu LUO ; Jiazhen YANG ; Baozhen ZHANG ; Jianmin WU ; Wenna LIU ; Zhongsheng LI ; Yiquan BAI
Chinese Journal of Veterinary Science 2024;44(11):2316-2323
In order to develop a positive quality control products for the detection of porcine repro-ductive and respiratory syndrome virus(PRRSV)nucleic acid by real-time fluorescent quantitative PCR(RT-qPCR),the positive quality control products of PRRSV-1 and PRRSV-2 M genes were prepared using armored RNA technology of MS2 phage.PRRSV-1 and PRRSV-2 M genes were amplified,purified and recovered,and ligated into pET28b vector containing MS2 mature enzyme protein gene and capsid protein.After transformed into BL21(DE3),the gene products were in-duced by IPTG and purified by PEG6000 precipitation method to prepare the armored RNA virus-like particles(AR-PRRSV)containing PRRSV M gene.Following the performance evaluation,as the positive quality control products of PRRSV-1 and PRRSV-2 M genes,AR-PRRSV1M and AR-PRRSV2M were calculated using YY/T 1652-2019 standard.Results showed that it had a good u-niformity,stable storage for the armored virus-like particles at-20,4,25 ℃ for 60 d,and 37 ℃ for 30 d.The prepared armored virus-like particles AR-PRRSV1M and AR-PRRSV2M were deter-mined by digital quantitative PCR(ddPCR)after preliminary quantification by RT-qPCR.The 104 copies/μL of AR-PRRSV1M and AR-PRRSV2M ddPCR fixation was(1.33+0.50)× 104 cop-ies/μL.The above results indicates that the AR-PRRSVM can be used as the quality control of the whole detection process(nucleic acid extraction,reverse transcription and RT-qPCR).
9.Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4
Tingting YANG ; Shuzhen MA ; Ling LYU ; Yuan CHEN ; Ya′nan ZHANG ; Xinli BAI
Chinese Journal of Applied Clinical Pediatrics 2023;38(6):457-460
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
10.Impact of COVID-19 epidemic on inventory of red blood cells in local and municipal blood stations in China
Weina CHEN ; Jianling ZHONG ; Yueping DING ; Weizhen LYU ; Jian ZHANG ; Lin BAO ; Feng YAN ; Li LI ; Dexu CHU ; Guanlin HU ; Ruijuan YANG ; Bo LI ; Xiaofeng ZHEN ; Youhua SHEN ; Wen ZHANG ; Jie YANG ; Wei ZHANG ; Yunfei LI ; Liang BAI ; Ning LI ; Yian LIANG ; Lili ZHU ; Qingsong YUAN ; Qingjie MA
Chinese Journal of Blood Transfusion 2023;36(10):903-906
【Objective】 To evaluate and analyze the impact of COVID-19 epidemic on inventory of red blood cells (RBCs)in local and municipal blood stations in China, and to provide reference for the management of public health emergencies. 【Methods】 Relevant data from 2018 to 2021 were collected, and the differences in the volume of qualified RBCs, the usage efficiency of inventory RBCs, the average daily distribution of RBCs,the blood distribution rate of RBCs prepared by 400 mL whole blood, the difference in the average storage days of RBCs at the time of distribution, the average daily inventory of RBCs and the time of the average daily inventory of RBCs to maintain the distribution in 24 local and municipal blood stations in China during the COVID-19 epidemic and non-epidemic periods were retrospectively analyzed. 【Results】 Compared with non-epidemic periods, the volume of qualified RBCs [(117 525.979 ±52 203.175)U] and the average daily distribution of RBCs [( 156. 468 ± 70. 186) U ] increased significantly, but the usage efficiency of inventory RBCs decreased(97.24%±0.51%) significantly (P<0.05).There was no significant difference in the blood distribution rate of RBCs prepared by 400 mL whole blood(73.88%±20.30%), the average storage days of RBCs distribution(13.040 ±3.486), the average daily stock quantity of RBCs[(2 280.542 ±1 446.538) U ] and the time of the average daily inventory of RBCs to maintain the distribution[(15.062 ±7.453) d] (P>0.5). 【Conclusion】 During the COVID-19 epidemic, the inventory management of RBCs operated well, the overall inventory remained relatively stable, the stock composition and storage period showed no significant change.

Result Analysis
Print
Save
E-mail