1.Role of mitochondrial permeability transition pore in lipid emulsion-induced inversion of bupivacaine myocardiotoxicity in rats
Libin YANG ; Zhixia BAI ; Danni LYU ; Haibo LIU ; Xuexin CHEN
Chinese Journal of Anesthesiology 2015;35(9):1050-1053
Objective To evaluate the effect of mitochondrial permeability transition pore (mPTP) in lipid emulsion-induced inversion of bupivacaine myocardiotoxicity in rats.Methods H9c2 cells were inoculated in 6-well plates at a density of 105 cells/ml, and were randomly divided into 4 groups (6 wells in each group, 2 ml/well) using a random number table: control group (group C) , bupivacaine group (group B) , lipid emusion + bupivacaine group (group LB) , and lipid emusion + bupivacaine + atractyloside group (group LBA).Phosphate buffer solution 100 μl was added to the culture medium in group C.In group B, bupivacaine was added to the culture medium with the final concentration of 1 mmol/L.In group LB, lipid emusion and bupivacaine were added to the culture medium with the final concentrations of 1% and 1 mmol/L, respectively.In group LBA, lipid emusion, bupivacaine and atractyloside (an mPTP opener) were added to the culture medium with the final concentrations of 1%, 1 mmol/L and 30 μmol/L, respectively.All the cells were incubated for 24 h.After the end of incubation, the expression of Bcl-2, Bax, phosphorylated Bad (p-Bad) , caspase-3, activated caspase-3, caspase-9,activated caspase-9 and cytochrome c (Cyt c) was detected using Western blot.The expression of Bcl-2 mRNA, Bax mRNA, Bad mRNA, caspase-9 mRNA and Cyt c mRNA was detected using real-time reverse transcriptase polymerase chain reaction.The ratios of Bax/Bcl-2, activated caspase-3/caspase-3, activated caspase-9/caspase-9, and Bax mRNA/Bcl-2 mRNA were calculated.Results Compared with group C,the ratios of Bax/Bcl-2, activated caspase-3/caspase-3, activated caspase-9/caspase-9, and Bax mRNA/ Bcl-2 mRNA were significantly increased, the expression of p-Bad was down-regulated, and the expression of Cyt c, Bad mRNA, caspase-9 mRNA and Cyt c mRNA was up-regulated in group B (P<0.05) , and no significant change was found in the parameters mentioned above in group LB (P>0.05).Compared with group B, the ratios of Bax/Bcl-2, activated caspase-3/caspase-3, activated caspase-9/caspase-9, and Bax mRNA/Bcl-2 mRNA were significantly decreased, the expression of p-Bad was up-regulated, and the expression of Cyt c, Bad mRNA, caspase-9 mRNA and Cyt c mRNA was down-regulated in LB and LBA groups (P< 0.05).Compared with group LB, the ratios of Bax/Bcl-2, activated caspase-3/caspase-3, activated caspase-9/caspase-9, and Bax mRNA/Bcl-2 mRNA were significantly increased, the expression of p-Bad was down-regulated, and the expression of Cyt c, Bad mRNA, caspase-9 mRNA and Cyt c mRNA was up-regulated in group LBA (P < 0.05).Conclusion The mechanism underlying lipid emulsioninduced inversion of bupivacaine myocardiotoxicity is related to inhibited mPTP opening in rats.
2.Effect of lipid emulsion on mitochondrial energy metabolism during bupivacaine-induced myocardiotoxicity in rats
Danni LYU ; Zhixia BAI ; Libin YANG ; Xuexin CHEN
Chinese Journal of Anesthesiology 2015;35(11):1344-1346
Objective To investigate the effect of lipid emulsion on mitochondrial energy metabolism during bupivacaine-induced myocardiotoxicity in rats.Methods H9c2 cells were inoculated in 96-well plates at a density of 1 × 105cells/ml, and were randomly divided into 4 groups (n =18 each) using a random number table: control group (group C) , bupivacaine group (group B) , lipid emulsion group (group LE) , and bupivacaine + lipid emulsion group (group B + LE).The cells were incubated in the normal culture medium in group C.In group LE, the cells were incubated in the culture medium containing 1% lipid emulsion.In group B, the cells were incubated in the culture medium containing 1 mmol/L bupivacaine.In group B + LE, the cells were incubated in the culture medium containing 1 mmol/L bupivacaine and 1% lipid emulsion.After 24 h of incubation, the contents of ATP, ADP, and AMP were measured by high-performance liquid chromatography, and apoptotic rate was calculated by Hoechst33342/ PI staining.Results Compared with group C, the contents of ATP, ADP and AMP were significantly decreased, and apoptotic rate was increased in group B (P<0.05), and the contents of ATP and ADP in group LE and ATP content in group B + LE were increased, and no significant changes were found in apoptotic rate in LE and B+LE groups (P>0.05).Compared with group C, the contents of ATP, ADP and AMP were significantly increased, and apoptotic rate was decreased in LE and B+LE groups (P< 0.05).Compared with group LE, the contents of ATP, ADP and AMP were significantly decreased (P< 0.05), and no significant change was found in apoptotic rate in group B+LE (P>0.05).Conclusion The mechanism by which lipid emulsion reduces bupivacaine-induced myocardiotoxicity may be associated with improved mitochondrial energy metabolism in rats.
3.Effects of Dexmedetomidine on Intraoperative Wake-up Quality of Patients Underwent Neurosurgical Oper-ation
Xianhui YANG ; Qian BAI ; Miaomiao LYU ; Hongguang FU ; Kai SUN ; Tieli DONG
China Pharmacy 2016;27(20):2841-2843
OBJECTIVE:To observe the influence and safety of dexmedetomidine (DEX) on intraoperative wake-up quality of patients underwent neurosurgical surgery. METHODS:126 patients with general anesthesia in neurosurgery were enrolled and randomized equally into observation group and control group,with 63 cases in each group. Control group was given target con-trolled infusion of propofol with plasma target concentration of 3-5 μg/ml and remifentanil with target effect site concentration of 2-6 ng/ml for anesthesia induction and maintenance,and then plasma target concentration of remifentanil decreased to 0.5 ng/ml 30 min before wake-up. Observation group received target controlled infusion of propofol with plasma target concentration of 3-5 μg/ml and remifentanil with target effect site concentration of 2-6 ng/ml for anesthesia induction and maintenance,and then given DEX 0.3 μg/kg intravenously 30 min before wake-up and maintained at 0.1 μg/(kg·h). MAP,HR,SBP,SaO2,serum levels of IgA,IgM,IgG,IL-6,IL-8 and TNF-α were observed in 2 groups 2 h before operation(T1)and after extubation(T2)as well as the occurrence of ADR during wake-up. RESULTS:There was no statistical significance in HR,MAP,SBP,SaO2,IgA,IgM, IgG,IL-6,IL-8 and TNF-α levels at T1 and SaO2 levels at T2 between 2 groups(P>0.05). HR,MAP,SBP,IL-6 and TNF-α lev-els of observation group decreased significantly at T2 and lower than those of control group;IgA,IgM and IgG increased signifi-cantly and higher than those of control group,with statistical significance (P<0.05). The incidence of bucking in observation group was significantly lower than control group,with statistical significance(P<0.05);there was no statistical significance in the incidence of ADR as dysphoria,awareness rate during operation,respiratory depression,body movement,bradycardia between 2 groups (P>0.05). CONCLUSIONS:DEX influence intraoperative wake-up quality of patients underwent neurosurgical surgery slightly,and can reduce inflammatory reaction with less ADR.
4.Influence of recurrence on outcome of acute ischemic stroke
Fangrui LI ; Chengyue BAO ; Zeyu HUANG ; Yumei GUO ; Lirong YANG ; Wenting BAI ; Liying LYU
Clinical Medicine of China 2015;31(10):910-914
Objective To explore the adverse effects of recurrence of acute ischemic stroke at discharge.Methods Continuously including 3 440 acute ischemic stroke patients from June 1,2009 to May 31, 2012 in Department of Neurology of the People's Hospital of Xinganmeng of Inner Mongoha Autonomous Region were esearch objects.Poor outcome was defined as the occurrence of disability or death at discharge.Disability was defined as the Modified Rankin ' s Scale (MRs), when MRs was 3 or more.Binary logistic regression was used to analysis the risk factors ,calculated the odds ratios(OR) and 95% confidence interval (95%CI).Results A total of 359 (10.44%) patients occurred poor outcomes, of whom 136 (37.88%) patients occurred the recurrence of ischemic stroke.Multiple logistic regression analysis showed that age (OR=1.24,95%CI 1.09-1.41), body temperature (OR =1.92,95 % CI 1.43-2.57), hypertension (OR =1.73,95 % CI 1.33-2.24), high blood sugar (OR=1.67,95%CI 1.26-2.20) ,glycerin trilaurate(OR=0.41,95%CI0.27-0.62) ,smoking (OR =1.37,95%CI 1.01-1.85) and recmrrence(OR=1.49,95%CI 1.15-1.95) were independent risk factors of poor outcome at discharge.The recurrence of acute ischemic stroke can increase the risk of the occurrence of poor outcome at discharge up to 49%.Conclusion Recurrence is an independent risk factor for the poor outcome of acute ischemic stroke, we should focus on secondary prevention of stroke patients at the clinical work and health education to reduce the recurrence of ischemic stroke.
5.Discriminating potential of extraintestinal systemic manifestations and colonoscopic features in Chinese patients with intestinal Behçet's disease and Crohn's disease.
Ji LI ; Pan LI ; Jing BAI ; Hong LYU ; Yue LI ; Hong YANG ; Bo SHEN ; Jia-Ming QIAN
Chinese Medical Journal 2015;128(2):233-238
BACKGROUNDThe distinction between intestinal Behηet's disease (BD) and Crohn's disease (CD) is always challenging due to many overlapping clinical features. We conducted a retrospective study to reveal valuable strategies for the differential diagnosis between intestinal BD and CD in Chinese patients based on their clinical and colonoscopic features.
METHODSThirty-five intestinal BD patients and 106 CD patients hospitalized from January 1983 to January 2010, who had ulcerative lesions in the terminal ileum or colon under colonoscopy and no history of gastrointestinal operation except appendectomy before admission, were enrolled. Univariate and multivariate logistic regression analyses were conducted to find discriminating predictors among demographic data, clinical manifestations, and colonoscopic findings.
RESULTSBased on univariate analysis, massive gastrointestinal hemorrhage, fever, and extraintestinal systemic manifestations were more common in intestinal BD patients (P = 0.022, 0.048 and 0.001, respectively), while diarrhea, intestinal obstruction, and perianal lesions were more common in CD patients (P = 0.002, 0.010, and 0.027 respectively). Based on colonoscopy, focal involvement, ileocecal valve deformity, solitary ulcers, large ulcers (ulcer size > 2 cm), and circumferential ulcers were more common in intestinal BD patients (P = 0.003, 0.003, 0.014, 0,013, and 0.003, respectively), while segmental involvement, longitudinal ulcers, a cobblestone or nodular appearance, and pseudo-polyps were more common in CD patients (P = 0.003, 0.008, 0.023, and 0.002, respectively). Based on multivariate logistic regression analysis, diarrhea, extraintestinal manifestations, ulcer distribution, size, and type, and pseudo-polyps were independent discriminating predictors between the two groups (P = 0.048, 0.008, 0.006, 0.021, 0.002, and 0.041, respectively). The discriminating algorithm composed of the above independent predictors had the highest area under the curve of 0.987 for distinguishing between the two diseases.
CONCLUSIONSExtraintestinal systemic manifestations and the characteristic colonoscopic features, such as ulcer distribution, size and type, helped to distinguish intestinal BD from CD.
Adolescent ; Adult ; Asian Continental Ancestry Group ; Behcet Syndrome ; diagnosis ; Colonoscopy ; Crohn Disease ; diagnosis ; Diagnosis, Differential ; Female ; Humans ; Male ; Young Adult
6.Analysis of clinical characteristics and gene mutations in children with progressive familial intrahepatic cholestasis type 2
Xinli BAI ; Ling LYU ; Tingting YANG ; Zhenzhong LI ; Shuzhen MA ; Huifeng ZHANG
Chinese Journal of Applied Clinical Pediatrics 2020;35(19):1503-1506
Objective:To investigate clinical characteristics and ABCB11 gene mutations in probands suffering from progressive familial intrahepatic cholestasis type 2(PFIC2). Methods:The clinical data involving manifestations and laboratory examinations of 2 probands with PFIC2 admitted to Pediatric Digestive and liver Clinic in Second Hospital of Hebei Medical University during January 2017 to December 2018 were retrospectively analyzed.Target capture high-throughput sequencing, genome-wide gene copy number variation(CNV) detection and validation were performed on probands and their parental DNA.Results:The age of onset for the 2 probands ranged from 2 to 5 months, and they had hepatosplenomegaly, severe cholestasis, pruritus, and binding bilirubin/ total bilirubin (proband 1: 51.8%-77.5%, proband 2: 47.1%-66.5%). Bile acid and aminotransferase[mainly aspartate transaminase (AST)] increased, but γ-glutamyltransferase(GGT) remained normal.Compound heterozygous mutations of ABCBll gene were discovered in proband 1: single strand deletion/c.3213+ 5G>A splicing mutation, and deletion mutation were spontaneous mutation.A total of 2.256 Mb(chr2 2q24.3q31.1)was missing, whereas splicing mutation was originated from her father.Polymorphisms with Val444Ala(T1331C)and Ala1028Ala(A3084G)were proved in proband 1.Compound heterozygous mutations of ABCB11 gene were revealed in proband 2: c.1483A>G(p.R495G)/c.2594C>T(p.A865V), and both parents were heterozygous carriers.Single-strand 2.256 Mb deletion in proband 1 and 2 mutations in proband 2 were unreported new mutations worldwide. Conclusions:In clinical work, children with cholestasis, elevated bile acid and transaminase(mainly AST), but normal GGT, should be detected for PFIC genes as soon as possible.
7.Clinical and genetic investigation of a multi-generational Chinese family afflicted with Von Hippel-Lindau disease.
Jingyao ZHANG ; Jie MA ; Xiaoyun DU ; Dapeng WU ; Hong AI ; Jigang BAI ; Shunbin DONG ; Qinling YANG ; Kai QU ; Yi LYU ; Robert K VALENZUELA ; Chang LIU
Chinese Medical Journal 2015;128(1):32-38
BACKGROUNDVon Hippel-Lindau (VHL) disease is a hereditary tumor disorder caused by mutations or deletions of the VHL gene. Few studies have documented the clinical phenotype and genetic basis of the occurrence of VHL disease in China. This study armed to present clinical and genetic analyses of VHL within a five-generation VHL family from Northwestern China, and summarize the VHL mutations and clinical characteristics of Chinese families with VHL according to previous studies.
METHODSAn epidemiological investigation of family members was done to collect the general information. A retrospective study of clinical VHL cases was launched to collect the relative clinical data. Genetic linkage and haplotype analysis were used to make sure the linkage of VHL to disease in this family. The VHL gene screening was performed by directly analyzing DNA sequence output. At last, we summarized the VHL gene mutation in China by the literature review.
RESULTSA five-generation North-western Chinese family afflicted with VHL disease was traced in this research. The family consisted of 38 living family members, of whom nine were affected. The individuals afflicted with VHL exhibited multi-organ tumors that included pheochromocytomas (8), central nervous system hemangioblastomas (3), pancreatic endocrine tumors (2), pancreatic cysts (3), renal cysts (4), and paragangliomas (2). A linkage analysis resulted in a high maximal LOD score of 8.26 (theta = 0.0) for the marker D3S1263, which is in the same chromosome region as VHL. Sequence analysis resulted in the identification of a functional C>T transition mutation (c. 499 C>T, p.R167W) located in exon 3 of the 167 th codon of VHL. All affected individuals shared this mutation, whereas the unaffected family members and an additional 100 unrelated healthy individuals did not. To date, 49 mutations have been associated with this disease in Chinese populations. The most frequent VHL mutations in China are p.S65 W, p.N78 S, p.R161Q and p.R167 W.
CONCLUSIONSThe results supported the notion that the genomic sequence that corresponds to the 167 th residue of VHL is a mutational hotspot. Further research is needed to clarify the molecular role of VHL in the development of organ-specific tumors.
Adolescent ; Adult ; Asian Continental Ancestry Group ; China ; Female ; Haplotypes ; genetics ; Humans ; Male ; Middle Aged ; Mutation ; Pedigree ; Retrospective Studies ; Von Hippel-Lindau Tumor Suppressor Protein ; genetics ; Young Adult ; von Hippel-Lindau Disease ; diagnosis ; genetics
8.Modified efficacy of thoracic paravertebral block combined with general anesthesia in patients undergoing laparoscopic radical nephrectomy
Shuaiguo LYU ; Xihua LU ; Changsheng LI ; Tiejun YANG ; Yalin SUN ; Yu BAI ; Jinxiu HUANG ; Xintao LI ; Changhong MIAO
Chinese Journal of Anesthesiology 2020;40(7):817-820
Objective:To evaluate the modified efficacy of thoracic paravertebral block (TPVB) combined with general anesthesia in the patients undergoing laparoscopic radical nephrectomy.Methods:Eighty patients, aged 38-64 yr, with body mass index of 18-24 kg/m 2, of American Society of Anesthesiologists physical status Ⅰ or Ⅱ, scheduled for elective laparoscopic radical nephrectomy, were selected and randomly divided into 2 groups ( n=40 each) using a random number table method: general anesthesia group (group GA) and TPVB combined with general anesthesia group (group TPVB+ GA). A paravertebral catheter was placed at T 8 and T 10 under ultrasound guidance before induction of anesthesia, and 0.5% ropivacaine 10 ml was administered via the catheter in group TPVB+ GA.Anesthesia was induced with propofol, sufentanil, etomidate and rocuronium and maintained by intravenous infusion of propofol and remifentanil.Patient-controlled intravenous analgesia was performed with sufentanil, ketorolac tromethamine and tropisetron at the end of surgery.When postoperative visual analog scale score≥4, tramadol 50 mg was intravenously injected as rescue analgesic.Immediately before anesthesia induction (T 0), at 5 min after establishing pneumoperitoneum (T 1), at 2 h of pneumoperitoneum (T 2), and immediately after the end of pneumoperitoneum (T 3), and at 24 h after operation (T 4), venous blood samples were collected for determination of plasma norepinephrine concentrations (by enzyme-linked immunosorbent assay), plasma cortisol level (using radioimmunoassay), and blood glucose concentrations were measured.The intraoperative consumption of sufentanil and remifentanil was recorded.The intraoperative hypertension, hypotension, and bradycardia were recorded, and the nausea and vomiting, pruritus, and requirement for rescue analgesia occurred within 24 h after surgery were recorded. Results:Compared with group GA, the plasma concentrations of norepinephrine, cortisol and blood glucose were significantly decreased at T 1-4, the intraoperative consumption of sufentanil and remifentanil was reduced, and the postoperative requirement for rescue analgesia was decreased in group TPVB+ GA ( P<0.05). There was no significant difference in the incidence of intraoperative and postoperative adverse reactions between the two groups ( P>0.05). Conclusion:TPVB combined with general anesthesia is helpful in carrying out the anesthetic model of low-consumption opioids and is more helpful in inhibiting intraoperative and postoperative stress responses and postoperative pain responses than general anesthesia alone when used for laparoscopic radical nephrectomy.
9.The early diagnostic value of tissue inhibitor of matrix metalloproteinase-2 and insulin-like growth factor binding protein-7 in sepsis-induced acute kidney injury
Qian YANG ; Wei CAO ; Diyu LYU ; Hong SUN ; Xiandong LIU ; Huijuan REN ; Mingzheng XU ; Xiuhua LI ; Jianwen BAI ; Lunxian TANG
Chinese Journal of Emergency Medicine 2020;29(9):1167-1172
Objective:To evaluate the early diagnostic value of tissue inhibitor of matrix metalloproteinase-2 (TIMP-2) and insulin-like growth factor binding protein-7 (IGFBP-7) in acute kidney injury induced by sepsis.Methods:A total of 85 sepsis patients admitted to the EICU and GICU in Shanghai East Hospital from September 2017 to June 2019 were divided into theAKI group ( n=37) and the non-AKI group ( n=48) according to KIDGO diagnostic criteria, and 20 healthy volunteers were served as the control group. The clinical data were recorded and samples of urine were collected at 0 h, 6 h, 12 h, 1 d, 3 d and 7 d post sepsis. The levels of TIMP-2 and IGFBP-7 in the urine were analyzed with ELISA at different time points. Based on the receiver operating characteristic curve (ROC) and the area under the curve (AUC), the early diagnostic value of urinary TIMP-2 and IGFBP-7 in sepsis-induced AKI patients was determined. Results:Compared with the control group, the levels of TIMP-2 and IGFBP-7 of the AKI group were significantly higher at the above time points ( P<0.05), while those of the non-AKI group showed no significant differences. The levels of TIMP-2 and IGFBP-7 of the AKI group were significantly higher than the those of the non-AKI group ( P<0.05). ROC analysis showed that when the AUC of urine TIMP-2 peaked at 1 d, the sensitivity and specificity reached 97.5% and 81.2%, separately with the cutoff value of 151.23 ng/mL. Furthermore, when the AUC of urine IGFBP-7 peaked at 12 h, the sensitivity and specificity reached 100% and 72.8%, separately with the cutoff value of 14.91 ng/mL. Interestingly, when the AUC of combined TIMP-2×IGFBP-7 peaked at 12 h, the sensitivity reached 98.0% and specificity reached 91.5% with the cutoff value of 2.09 [(ng/mL) 2/1 000]. There was no significant correlation between the levels of TIMP-2 and IGFBP-7 with SOFA and APACHEⅡ score at 1 d, 3 d and 7 d post sepsis in the AKI group ( P>0.05). Conclusions:Urine TIMP-2 and IGFBP-7 have early diagnostic value in sepsis-induced AKI. Besides, the combination of the two biomarkers have superior predictive value than each single of them.
10.Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4
Tingting YANG ; Shuzhen MA ; Ling LYU ; Yuan CHEN ; Ya′nan ZHANG ; Xinli BAI
Chinese Journal of Applied Clinical Pediatrics 2023;38(6):457-460
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.