Autism is a group of etiology and clinical heterogeneous neurodevelopmental disorders with an onset before 3 years old. It has 3 core characteristics: deficits in verbal communication; impairment of social interaction; restricted interests and repetitive behaviors. The incidence is increasing over time worldwide. Twin and family studies have demonstrated that autism has a high heritability (>90%). Although certain progress of autism genetic study has been made in the last decades and several autism susceptibility genes and loci have been identified, there are still about 70%-80% of patients for whom an autism-related genetic change cannot be identified.
Autistic Disorder ; genetics ; Child, Preschool ; Epigenomics ; Genetic Heterogeneity ; Humans ; Infant

Autism spectrum disorder (ASD) is one of the most complex behavioral disorders with a strong genetic influence. The objectives of this article are to review the current status of genetic research in ASD, and to provide information regarding the potential candidate genes, mutations, and genetic loci possibly related to pathogenesis in ASD. Investigations on monogenic causes of ASD, candidate genes among common variants, rare de novo mutations, and copy number variations are reviewed. The current possible clinical applications of the genetic knowledge and their future possibilities are highlighted.
Autistic Disorder* ; Child ; Autism Spectrum Disorder* ; Genetic Loci ; Genetic Research ; Genetics*

Humans ; Autistic Disorder ; China/epidemiology* ; Cohort Studies ; Autism Spectrum Disorder/genetics* ; Asian People

OBJECTIVE: To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism. METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis. RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin. CONCLUSION The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Autistic Disorder/genetics* ; Child ; Developmental Disabilities ; Female ; Humans ; Mutation ; Retrospective Studies ; Syndrome ; Transcription Factors/genetics*

OBJECTIVE: To explore the genetic basis for a child featuring idiopathic epilepsy and autism. METHODS: Peripheral blood samples of the child and his parents were collected with informed consent for the extraction of genome DNA. Whole exome sequencing was carried out for the family trio. Candidate variants were verified by Sanger sequencing and bioinformatic analysis. RESULTS: The proband was found to harbor a heterozygous nonsense c.3025C>T (p.Arg1009Ter) variant in exon 7 of the CASR gene exon 7, which may produce a truncated protein. Based on the guidelines of the American College of Medical Genetics and Genomics, the variant was predicted to be deleterious and classified as possibly pathogenic (PVS1+PM2). CONCLUSION The c.3025C>T (p.Arg1009Ter) variant of the CASR gene probably underlay the disease in this child.
Autistic Disorder ; Child ; Epilepsy/genetics* ; Exons ; Heterozygote ; Humans ; Receptors, Calcium-Sensing/genetics* ; Whole Exome Sequencing

Autistic Disorder ; genetics ; Chromosome Aberrations ; Chromosomes, Human, Pair 15 ; Humans ; Infant ; Male

OBJECTIVE: To carry out genome-wide copy number variations (CNVs) analysis for a boy with autism by using single nucleotide polymorphism array (SNP array). METHODS: SNP array analysis was conducted for the boy and his parents, and the data was validated by real-time PCR. Correlation between the deleted genes and the phenotype was analyzed by reviewing the literature. RESULTS: The patient was found to carry a terminal deletion of 18q22.3q23 (7.1 Mb), which involved FBXO15, ZNF407, ZADH2, TSHZ1, MBP and ADNP2 genes. No pathogenic CNVs were found in the parents. Comparison of the patient with cases reported in the literature suggested that the ZNF407 gene probably accounts for the autistic phenotype in these patients. CONCLUSION The autistic phenotype of the patient may be attributed to the 18q deletion, for which ZNF407 may be a critical candidate. SNP array has provided an useful tool for the study of molecular mechanism underlying autism.
Autistic Disorder ; genetics ; DNA Copy Number Variations ; Humans ; Male ; Microarray Analysis ; Polymorphism, Single Nucleotide

Autism spectrum disorder (ASD) is characterized by impairment in two behavioral domains: social interaction/communication together with the presence of stereotyped behaviors and restricted interests. The heterogeneity in the phenotype among patients and the complex etiology of the disorder have long impeded the advancement of the development of successful pharmacotherapies. However, in the recent years, the integration of findings of multiple levels of research, from human genetics to mouse models, have made considerable progress towards the understanding of ASD pathophysiology, allowing the development of more effective targeted drug therapies. The present review discusses the current state of pharmacological research in ASD based on the emerging common pathophysiology signature.
Animals ; Autistic Disorder* ; Child ; Autism Spectrum Disorder* ; Drug Therapy ; Genetics, Medical ; Humans ; Mice ; Phenotype ; Population Characteristics ; Social Behavior ; Stereotyped Behavior

Autism Spectrum Disorder (ASD) is characterized by persistent deficits in social communication and restricted, repetitive patterns of behavior and interest. Sleep problems are not uncommon in children with autism spectrum disorders. Symptoms of insomnia are the most frequent sleep problems in individuals with ASD. Sleep problems can cause significant difficulties in the daily life of children with ASD and their families. Genetic factor, deregulations of melatonin synthesis, extraneous environmental stimuli and psychiatric and medical conditions may cause sleep problems. The first line treatment of sleep problems in ASD includes managements for potential contributing factors and parent education about sleep hygiene care for child and behavioral therapy. Supplementation with melatonin may be effective before considering other medications, such as risperidone, clonidine, and mirtazapine.
Autistic Disorder* ; Child ; Autism Spectrum Disorder* ; Clonidine ; Education ; Genetics ; Humans ; Hygiene ; Melatonin ; Parents ; Risperidone ; Sleep Initiation and Maintenance Disorders

OBJECTIVE: To explore the genetic basis for a child manifesting with intellectual disability, language delay and autism spectrum disorder. METHODS: Genomic DNA was extracted from peripheral blood samples of the child and his family members, and subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and interpreted according to the guidelines of the American College of Medical Genetics and Genomics. RESULTS: The child was found to harbor a heterozygous c.568C>T (p.Q190X) nonsense variant of the ADNP gene, which was not detected in either parent by Sanger sequencing. CONCLUSION The clinical and genetic testing both suggested that the child has Helsmoortel-van der Aa syndrome due to ADNP gene mutation, which is extremely rare in China.
Abnormalities, Multiple/genetics* ; Autism Spectrum Disorder/genetics* ; Autistic Disorder/genetics* ; Child ; Heterozygote ; Homeodomain Proteins/genetics* ; Humans ; Intellectual Disability/genetics* ; Mutation ; Nerve Tissue Proteins/genetics* ; Rare Diseases