1.Quality Evaluation of Naomaili Granules Based on Multi-component Content Determination and Fingerprint and Screening of Its Anti-neuroinflammatory Substance Basis
Ya WANG ; Yanan KANG ; Bo LIU ; Zimo WANG ; Xuan ZHANG ; Wei LAN ; Wen ZHANG ; Lu YANG ; Yi SUN
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(2):170-178
ObjectiveTo establish an ultra-performance liquid fingerprint and multi-components determination method for Naomaili granules. To evaluate the quality of different batches by chemometrics, and the anti-neuroinflammatory effects of water extract and main components of Naomaili granules were tested in vitro. MethodsThe similarity and common peaks of 27 batches of Naomaili granules were evaluated by using Ultra performance liquid chromatography (UPLC) fingerprint detection. Ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) technology was used to determine the content of the index components in Naomaili granules and to evaluate the quality of different batches of Naomaili granules by chemometrics. LPS-induced BV-2 cell inflammation model was used to investigate the anti-neuroinflammatory effects of the water extract and main components of Naomaili granules. ResultsThe similarity of fingerprints of 27 batches of samples was > 0.90. A total of 32 common peaks were calibrated, and 23 of them were identified and assigned. In 27 batches of Naomaili granules, the mass fractions of 14 components that were stachydrine hydrochloride, leonurine hydrochloride, calycosin-7-O-glucoside, calycosin,tanshinoneⅠ, cryptotanshinone, tanshinoneⅡA, ginsenoside Rb1, notoginsenoside R1, ginsenoside Rg1, paeoniflorin, albiflorin, lactiflorin, and salvianolic acid B were found to be 2.902-3.498, 0.233-0.343, 0.111-0.301, 0.07-0.152, 0.136-0.228, 0.195-0.390, 0.324-0.482, 1.056-1.435, 0.271-0.397, 1.318-1.649, 3.038-4.059, 2.263-3.455, 0.152-0.232, 2.931-3.991 mg∙g-1, respectively. Multivariate statistical analysis showed that paeoniflorin, ginsenoside Rg1, ginsenoside Rb1 and staphylline hydrochloride were quality difference markers to control the stability of the preparation. The results of bioactive experiment showed that the water extract of Naomaili granules and the eight main components with high content in the prescription had a dose-dependent inhibitory effect on the release of NO in the cell supernatant. Among them, salvianolic acid B and ginsenoside Rb1 had strong anti-inflammatory activity, with IC50 values of (36.11±0.15) mg∙L-1 and (27.24±0.54) mg∙L-1, respectively. ConclusionThe quality evaluation method of Naomaili granules established in this study was accurate and reproducible. Four quality difference markers were screened out, and eight key pharmacodynamic substances of Naomaili granules against neuroinflammation were screened out by in vitro cell experiments.
2.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
3.Fabrication and evaluation of an inositol hexaphosphate-zinc hydrogel with dual capabilities of self-mineralization and osteoinduction
LIU Mingyi ; MIAO Xiaoyu ; CAI Yunfan ; WANG Yan ; SUN Xiaotang ; KANG Jingrui ; ZHAO Yao ; NIU Lina
Journal of Prevention and Treatment for Stomatological Diseases 2026;34(1):29-40
Objective:
To fabricate a hydrogel loaded with inositol hexaphosphate-zinc and preliminarily evaluate its performance in self-mineralization and osteoinduction, thereby providing a theoretical basis for the development of bone regeneration materials.
Methods:
The hydrogel framework (designated DF0) was formed by copolymerizing methacryloyloxyethyltrimethylammonium chloride and four-armed poly(ethylene glycol) acrylate, followed by sequentially loading inositol hexaphosphate anions via electrostatic interaction and zinc ions via chelation. The hydrogel loaded only with inositol hexaphosphate anions was named DF1, while the co-loaded hydrogel was named DF2. The self-mineralization efficacy of the DF0 , DF1 and DF2 hydrogels was characterized using scanning electron microscopy, transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and selected area electron diffraction (SAED). The biocompatibility was assessed via live/dead cell staining and a CCK-8 assay. The osteoinductive capacity of the DF0 , DF1 and DF2 hydrogels on MC3T3-E1 cells was assessed via alkaline phosphatase (ALP) and Alizarin Red S (ARS) staining. In the aforementioned cell experiments, cells cultured in standard medium served as the control group
Results:
The DF0, DF1, and DF2 hydrogels were successfully synthesized. Notably, DF1 and DF2 exhibited distinct self-mineralization within 6 days. Results from TEM, EDS, and SAED confirmed that the mineralization products were amorphous calcium phosphate in group DF1, and amorphous calciumzinc phosphate in group DF2. Biocompatibility tests revealed that none of the hydrogels (DF0, DF1, and DF2) adversely affected cell viability or proliferation. In osteogenic induction experiments, both ALP and ARS staining were intensified in the DF1 and DF2 groups, with the most profound staining observed in the DF2 group.
Conclusion
The developed inositol hexaphosphate-zinc hydrogel (DF2) demonstrates the dual capacity to generate calcium-phosphate compounds through self-mineralization while exhibiting excellent osteoinductive properties. This biocompatible, dual-promoting osteogenic hydrogel presents a novel strategy for bone regeneration.
4.Clinical rapid evaluation of proprotein convertase subtilisin/kexin type 9 inhibitors for hypercholesterolemia
Xin YAO ; Fengjiao KANG ; Qinan YIN ; Lizhu HAN ; Yuan BIAN
China Pharmacy 2026;37(2):149-154
OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 (PCSK9) inhibitors in China, including evolocumab, tafolecimab, recaticimab, ebronucimab, ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions (second edition), drug instructions, clinical diagnosis and treatment guidelines, and literature for six drugs were retrieved from CNKI, Wanfang Data, VIP, PubMed, Embase, Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects: pharmaceutical characteristics, effectiveness, safety, economy, and other attributes. RESULTS The pharmaceutical characteristics, effectiveness, safety, economy, other attributes, and total score of evolocumab scored 24, 27, 15.7, 10, 5.3, and 82 points, respectively. Tafolecimab scored 23.5, 23, 11.5, 9.97, 4.6, and 72.57 points, respectively. Recaticimab scored 20.5, 22, 15.5, 6.37, 3.5, and 67.87 points. Ebronucimab scored 20, 23, 11, 6.48, 3.5, and 63.98 points. Ongericimab scored 20.5, 23, 8.5, 4.83, 3.5, and 60.33 points. Inclisiran scored 25.5, 24, 13, 6.48, 5, and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option, and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.
5.Cost-effectiveness analysis of cefiderocol for the treatment of confirmed or suspected carbapenem-resistant Gram-negative bacteria serious infections
Yuan GONG ; Shuo KANG ; Yibing HOU ; Xiaohui WANG ; Ying NIE ; Jing WANG ; Zhenhua PAN
China Pharmacy 2026;37(2):192-197
OBJECTIVE To evaluate the cost-effectiveness of cefiderocol versus best available therapy (BAT) or standard-of- care (SOC) for the treatment of confirmed or suspected carbapenem-resistant Gram-negative bacterial (CRGNB) serious infections from the perspective of the Chinese healthcare system, and to explore its reasonable pricing. METHODS A decision tree model was constructed based on data from two phase Ⅲ clinical trials (CREDIBLE-CR and GAME CHANGER) to simulate the cost- effectiveness of cefiderocol in two scenarios: salvage therapy for confirmed CRGNB infection (scenario 1) and empirical therapy for suspected CRGNB infection (scenario 2). The primary outcome measure was the incremental cost-effectiveness ratio (ICER). The willingness-to-pay (WTP) was set at 1 to 3 times China’s per capita GDP in 2024. To verify the robustness of the results, one- way and probabilistic sensitivity analyses were conducted, and based on these, a reasonable price range for cefiderocol in the Chinese market was explored. RESULTS The results for scenario 1 showed that the clinical cure rate in the cefiderocol group was higher than that in the BAT group (47.50% vs. 34.21%), but its ICER was 415 065.03 yuan per cured case, exceeding three times China’s GDP per capita. Scenario 2 revealed that the ICER for cefiderocol relative to SOC was as high as 1 362 446.16 yuan per cured case, far exceeding the WTP. Sensitivity analysis indicated that the treatment duration and price of cefiderocol were key factors affecting its cost-effectiveness. In the two scenarios described above, the unit price of cefiderocol must fall below 683.47 and 242.00 yuan/g, respectively, to be considered cost-effective. CONCLUSIONS Based on the current market price, cefiderocol lacks sufficient cost-effectiveness for treating confirmed or suspected CRGNB serious infections within China’s healthcare system. To improve its accessibility, price negotiations or a tiered medical insurance payment strategy are required.
6.Anti-osteoporosis Effect of Isorhamnetin: A Review
Shilong MENG ; Xu ZHANG ; Yawei XU ; Yang YU ; Wei LI ; Yanguang CAO ; Xiaolin SHI ; Wei ZHANG ; Kang LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(5):347-352
Osteoporosis is a common senile bone metabolism disease, clinically characterized by decreased bone mass, destruction of bone microstructure, increased bone fragility, and easy fracture. It tends to occur in the elderly and postmenopausal women, seriously threatening the quality of life and physical and mental health of the elderly. At present, the treatment of osteoporosis is mainly based on oral western medicines, such as calcium, Vitamin D, and bisphosphonates. Still, there are drawbacks such as a long medication cycle and many adverse reactions. In recent years, due to the advantages of multi-component, multi-pathway, and multi-target, some traditional Chinese medicines and effective ingredients can regulate the osteogenic and osteoclastic differentiation process in both directions and are widely used in the prevention and treatment of osteoporosis. Hippophae rhamnoides is a commonly used herbal medicine, and its fruits are rich in flavonoids, polyphenols, fatty acids, vitamins, and trace elements, which have been proven to have a good anti-osteoporosis effect. Isorhamnetin is the main effective ingredient of Hippophae rhamnoides fruits, which has many pharmacological effects such as anti-inflammation, anti-oxidative stress, anti-aging, and anti-tumor. Studies have shown that isorhamnetin can participate in the regulation of bone metabolism and has a good anti-osteoporosis effect. However, the pharmacological effects and related mechanisms of isorhamnetin against osteoporosis have not been systematically summarized. Therefore, this paper reviewed the pharmacological effects and related mechanisms of isorhamnetin against osteoporosis by referring to relevant literature to provide more basis for the development and application of isorhamnetin.
7.Palpitations, Shortness of Breath, Weakness in Limbs, Edema, and Dyspnea: A Rare Inflammatory Myopathy with Positive Aniti-mitochondrial Antibodies and Cardiac Involvement
Chunsu LIANG ; Xuchang ZHANG ; Ning ZHANG ; Lin KANG ; Xiaohong LIU ; Jiaqi YU ; Yingxian LIU ; Lin QIAO ; Yanli YANG ; Xiaoyi ZHAO ; Ruijie ZHAO ; Na NIU ; Xuelian YAN
Medical Journal of Peking Union Medical College Hospital 2025;16(1):248-255
This article presents a case study of a patient who visited the Geriatric Department of Peking Union Medical College Hospital due to "palpitations, shortness of breath for more than 2 years, limb weakness for 6 months, edema, and nocturnal dyspnea for 2 months". The patient exhibited decreased muscle strength in the limbs and involvement of swallowing and respiratory muscles, alongside complications of heart failure and various arrhythmias which were predominantly atrial. Laboratory tests revealed the presence of multiple autoantibodies and notably anti-mitochondrial antibodies. Following a comprehensive multidisciplinary evaluation, the patient was diagnosed with anti-mitochondrial antibody-associated inflammatory myopathy. Treatment involved a combination of glucocorticoids and immunosuppressants, along with resistance exercises for muscle strength and rehabilitation training for lung function, resulting in significant improvement of clinical symptoms. The case underscores the importance of collaborative multidisciplinary approaches in diagnosing and treating rare diseases in elderly patients, where careful consideration of clinical manifestations and subtle abnormal clinical data can lead to effective interventions.
8.Principles, technical specifications, and clinical application of lung watershed topography map 2.0: A thoracic surgery expert consensus (2024 version)
Wenzhao ZHONG ; Fan YANG ; Jian HU ; Fengwei TAN ; Xuening YANG ; Qiang PU ; Wei JIANG ; Deping ZHAO ; Hecheng LI ; Xiaolong YAN ; Lijie TAN ; Junqiang FAN ; Guibin QIAO ; Qiang NIE ; Mingqiang KANG ; Weibing WU ; Hao ZHANG ; Zhigang LI ; Zihao CHEN ; Shugeng GAO ; Yilong WU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):141-152
With the widespread adoption of low-dose CT screening and the extensive application of high-resolution CT, the detection rate of sub-centimeter lung nodules has significantly increased. How to scientifically manage these nodules while avoiding overtreatment and diagnostic delays has become an important clinical issue. Among them, lung nodules with a consolidation tumor ratio less than 0.25, dominated by ground-glass shadows, are particularly worthy of attention. The therapeutic challenge for this group is how to achieve precise and complete resection of nodules during surgery while maximizing the preservation of the patient's lung function. The "watershed topography map" is a new technology based on big data and artificial intelligence algorithms. This method uses Dicom data from conventional dose CT scans, combined with microscopic (22-24 levels) capillary network anatomical watershed features, to generate high-precision simulated natural segmentation planes of lung sub-segments through specific textures and forms. This technology forms fluorescent watershed boundaries on the lung surface, which highly fit the actual lung anatomical structure. By analyzing the adjacent relationship between the nodule and the watershed boundary, real-time, visually accurate positioning of the nodule can be achieved. This innovative technology provides a new solution for the intraoperative positioning and resection of lung nodules. This consensus was led by four major domestic societies, jointly with expert teams in related fields, oriented to clinical practical needs, referring to domestic and foreign guidelines and consensus, and finally formed after multiple rounds of consultation, discussion, and voting. The main content covers the theoretical basis of the "watershed topography map" technology, indications, operation procedures, surgical planning details, and postoperative evaluation standards, aiming to provide scientific guidance and exploration directions for clinical peers who are currently or plan to carry out lung nodule resection using the fluorescent microscope watershed analysis method.
9.Advances in neoadjuvant therapy for locally advanced resectable esophageal cancer
Xiaozheng KANG ; Ruixiang ZHANG ; Zhen WANG ; Xiankai CHEN ; Yong LI ; Jianjun QIN ; Yin LI
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):153-159
Neoadjuvant therapy has become the standard treatment for locally advanced resectable esophageal cancer, significantly improving long-term survival compared to surgery alone. Neoadjuvant therapy has evolved to include various strategies, such as concurrent chemoradiotherapy, chemotherapy, immunotherapy, or targeted combination therapy. This enriches clinical treatment options and provides a more personalized and scientific treatment approach for patients. This article aims to comprehensively summarize current academic research hot topics, review the rationale and evaluation measures of neoadjuvant therapy, discuss challenges in restaging methods after neoadjuvant therapy, and identify the advantages and disadvantages of various neoadjuvant therapeutic strategies.
10.Challenges and future directions of medicine with artificial intelligence
Xiaoqin ZHOU ; Huizhen LIU ; Ting WANG ; Xueting LIU ; Fang LIU ; Deying KANG
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(02):244-251
This comprehensive review systematically explores the multifaceted applications, inherent challenges, and promising future directions of artificial intelligence (AI) within the medical domain. It meticulously examines AI's specific contributions to basic medical research, disease prevention, intelligent diagnosis, treatment, rehabilitation, nursing, and health management. Furthermore, the review delves into AI's innovative practices and pivotal roles in clinical trials, hospital administration, medical education, as well as the realms of medical ethics and policy formulation. Notably, the review identifies several key challenges confronting AI in healthcare, encompassing issues such as inadequate algorithm transparency, data privacy concerns, absent regulatory standards, and incomplete risk assessment frameworks. Looking ahead, the future trajectory of AI in healthcare encompasses enhancing algorithm interpretability, propelling generative AI applications, establishing robust data-sharing mechanisms, refining regulatory policies and standards, nurturing interdisciplinary talent, fostering collaboration among industry, academia, and medical institutions, and advancing inclusive, personalized precision medicine. Emphasizing the synergy between AI and emerging technologies like 5G, big data, and cloud computing, this review anticipates a new era of intelligent collaboration and inclusive sharing in healthcare. Through a multidimensional analysis, it presents a holistic overview of AI's medical applications and development prospects, catering to researchers, practitioners, and policymakers in the healthcare sector. Ultimately, this review aims to catalyze the deep integration and innovative deployment of AI technology in healthcare, thereby driving the sustainable advancement of smart healthcare.


Result Analysis
Print
Save
E-mail