1.CT manifestations of pancreatic tuberculosis
Risheng YU ; Ji ai ZHENG ; Rongfen LI
Chinese Journal of Radiology 2001;35(1):56-59
Objective To assess the CT manifestations and diagnostic value in the pancreatic tuberculosis(PTB)with review of the literatures. Methods All cases of PTB proved by surgery or biopsy were examined with plain and enhanced CT scans. Results The CT findings in one case with multiple-nodular type of PTB were diffuse enlargement of the pancreas with multiple, nodular, and low-density lesions; The nodular lesions had peripheral enhancement. 7 cases of local type of PTB encroached on pancreatic head. 4 cases showed local soft tissue masses with multiple flecked calcifications in 2 cases and mild enhancement in one case; Cystic masses was found in 2 cases, with mural calcification in 1 case and multiloculated cystic mass in 1 case, respectively; Massive pancreatic head calcification was demonstrated in one case. In these 8 cases of PTB, the lesion extended out of pancreas in 4 cases, including abdominal tuberculous lymph nodes, tuberculous peritonitis, and hepatosplenic tuberculosis. Conclusion CT findings of PTB were various but had some characteristics. Pancreatic masses with multiple flecked calcification or mild enhancement could suggest the diagnosis. Abdominal tuberculosis accompanied with the pancreatic lesion, especially tuberculous lymph nodes, was highly suggestive of the diagnosis of PTB.
2.Purification of Recombinant Fusion Protein Staphylokinase-Hirudin Expressed by Escherichia coli and Analysis of its Dimer
Gen-Shen ZHONG ; Ai-Ping YU ; Ji-De JIN ; Zhong-Hua JIANG ; Zu-Ze WU ;
China Biotechnology 2006;0(02):-
The recombinant fusion protein staphylokinase-hirudin(rSFH) was purified from the high density-fermented engineered E.coli by means of ion-exchange chromatography (IEC) and gel filtration (GF). The purity of rSFH reached to more than 98% determined by RP-HPLC and SDS-PAGE, and the yield was up to 0.7g per liter of fermentation broth. The analysis of homologous dimmer of rSFH appeared during the purification and calculation of the surface hydrophobic area had been carried out by means of hydrophobic chromatography and MALD-TOF. The influence of sodium chloride and temperature on the behavior of rSFH reversible dimerization was analyzed by high performance sized- exclusive chromatography(HPSEC). It is concluded that the hydrophobic interaction played an important role in the reversible dimerization of rSFH.
3.Study on Etiology of Acute Pneumonia in Children in Suzhou Area
yu-qing, WANG ; wei, JI ; zheng-rong, CHEN ; ai-li, ZHANG
Journal of Applied Clinical Pediatrics 2003;0(10):-
Objective To investigate etiology of acute pneumonia in children in order to provid basis for clinical diagnosis and treatment.Methods The children with acute pneumonia who were hospitalized in children's hospital affiliated to Suzhou university were selected.And the sputum of them were collected.Bacteria and virus were tested using sputum culture and direct immunofluoresence respectively.Antibodies against mycoplasma and chlamydia were detected by enzymelinked immunosorbent assay(ELISA) in paired sera. Results Microbial etiology was obtained in 360 cases (67.7%) of 532 patients.Viral infections were in 178 cases (33.5%).Bacterial infections were in 23 cases (4.3%),mycoplasma pneumoniae 50 cases (9.4%) and chlamydia pneumoniae 19 cases (3.6%),compound infections 90 cases (16.9%).Respiratory syncycial virus was the major viral pathogen,streptococcus pneumoniae were the prominent pathagens of bacterial pneumonia,followed by haemophilus influenza.Conclusions Viral infection is the most common cause of acute pneumonia in children in Suzhou area during winter and spring,followed by mycoplasma pneumoniae,bacteria and chlamydia pneumoniae.Mycoplasma pneumoniae infection is more common in children older than 3 years,chlamydia pneumoniae infection is more in infants less than 3 months,most of compound infection children were below the age of 3 years.
4.Application of 'waist circumference cutoff point' in screening diabetes mellitus among rural residents in mid-western area of Shandong province,China
Yang YU ; Ji-Xiang MA ; Ai-Qiang XU ; Ai-Tian YIN ; Wei-Ka LI ; Jia-Ye LIU ; Gui-Shun IIE
Chinese Journal of Epidemiology 2008;29(9):865-868
Objective To determine the value and the optimal cutoff point of waist circumference (WC) in screening diabetes mellitus (DM) and to provide evidence for DM prevention and identifying population at risk in mid-western rural areas of Shandong province.Methods A sample consisting 16 341 rural residents was selected and studied.All participants were physically examined on height,weight,WC and fasting plasma glucose (FPG).Oral glucose tolerance test (OGTT) was performed for subjects with FPG valued from 6.1 to 7.0 mmol/L.DM was defined according to the criteria set by WHO in 1999.Area under the curve (AUC),sensitivity,specificity and Youden index were computed based on the receiver operating characteristic (ROC) curve analysis.Optimal cutoff point was determined by the maximum of Youden index.Results The prevalence rates of DM for males and females increased along with the rise of WC (trend test X2=72.01,122.65,P<0.01 ).It appeared significantly higher in those with WC 85 cm in females and≥80 cm in males,with those WC <85 cm for females and <80 cm for males,in particular.AUCs were 0.639 and 0.655 for males and females respectively and both had significant differences (t=7.22,11.07,P <0.01 ).However,the AUCs did not show significant difference (t=0.70,P > 0.05) between males and females.The Youden index reached maximum when WC approached 85 cm for females (24.90%) and 80 cm for males (24.39%).The sensitivity and specificity were 58.04%and 66.86%for males,and 67.08%and 57.31%for females.Conclusion WC seemed to be an effective indicator for screening the DM.The optimal cutoff point of WC would be 85 cm for females and 80 cm for males in screening DM and defining the population at risk in this area.
5.Lipid compounds from Echinacea purpurea.
Ji-ren LII ; Xiu-fen GAO ; Tie-min AI ; Yu-ying ZHAO
China Journal of Chinese Materia Medica 2002;27(1):40-42
OBJECTIVETo study the lipid constituents from Echinacea purpurea.
METHODThe compounds were isolated by chromatography method and the structures were identified on the basis of spectral analyses.
RESULTFive compounds were isolated and identified as, 1 beta, 6 alpha-dihydroxy-4(14)-eudesmene(1), (2E, 4E, 8Z, 10E)-N-isobutyl-2,4,8,10-dodecatetraenamide(2), (2E, 4E, 8Z, 10Z)-N-isobutyl-2,4,8,10-dodecatetraenamide(3), cerotic acid(4), hyxacosyl alcohol(5).
CONCLUSIONCompounds 1,4 and 5 were obtained from the plant for the first time.
Echinacea ; chemistry ; Fatty Acids ; chemistry ; isolation & purification ; Fatty Alcohols ; chemistry ; isolation & purification ; Plants, Medicinal ; chemistry ; Sesquiterpenes ; chemistry ; isolation & purification
6.Advances in the study of the chemical constituents and biological activities of 3 species of Echinacea.
Ji-ren LI ; Yu-ying ZHAO ; Tie-min AI
China Journal of Chinese Materia Medica 2002;27(5):334-337
Adjuvants, Immunologic
;
pharmacology
;
Animals
;
Anti-Inflammatory Agents, Non-Steroidal
;
pharmacology
;
Antiviral Agents
;
pharmacology
;
Caffeic Acids
;
chemistry
;
isolation & purification
;
pharmacology
;
Drugs, Chinese Herbal
;
isolation & purification
;
pharmacology
;
Echinacea
;
chemistry
;
classification
;
Fatty Acids, Unsaturated
;
isolation & purification
;
pharmacology
;
Molecular Structure
;
Plants, Medicinal
;
chemistry
;
Polyunsaturated Alkamides
7.Sensitization of human colon cancer HT-29 cells to TRAIL-induced apoptosis by gambognic acid.
Ji-lin YE ; You-jiang YU ; Ai-lian WU ; Dong-yan WANG ; Yong-chun LIU ; Yan-qing LIU
Acta Pharmaceutica Sinica 2015;50(10):1252-1257
To investigate the effects of gambognic acid (GA) on TRAIL-induced apoptosis of cancer cells, human colon HT-29 cancer cells were treated with GA to promote apoptosis. Inhibition of the cell proliferation was measured with MTT assay and cell apoptosis was detected with formation of DNA ladders in agarose gel electrophoresis, and activation of caspase activity. The content of cytosolic reactive oxygen species (ROS) was measured with flow cytometry. The activities of Caspase-3, -8, -9 were detected using spectrophotometric assay. The levels of c-FLIP, CHOP, DR4 and DR5 in cells were tested by Western blot. Combination of GA (1 µg · mL(-1)) and TRAIL (40 ng · mL(-1)) significantly reduced proliferation and increased apoptosis of HT-29 cells over those induced by each agent alone. Percentage of apoptotic cells was increased to 45.5%. GA markedly enhanced the intracellular ROS generation. Expression of CHOP, DR4 and DR5 was up-regulated to 7.38, 5.41, and 4.85 times of the control group, respectively. GA promoted activation of Caspase-3, -8, and -9 by TRAIL (P<0.05). Furthermore, the expression of anti-apoptotic protein c-FLIP was down-regulated to 0.22 ± 0.08 times of the control group. In conclusion, GA sensitizes HT-29 cells to TRAIL-induced apoptosis by promoting ROS-activated ERS pathways, up-regulating of DR4 and DR5, and inhibiting c-FLIP expression.
Apoptosis
;
Apoptosis Regulatory Proteins
;
metabolism
;
Caspases
;
metabolism
;
Cell Line, Tumor
;
Cell Proliferation
;
Colonic Neoplasms
;
metabolism
;
Down-Regulation
;
HT29 Cells
;
Humans
;
Reactive Oxygen Species
;
metabolism
;
TNF-Related Apoptosis-Inducing Ligand
;
pharmacology
;
Up-Regulation
;
Xanthones
;
pharmacology
8.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
9.Bio-oil production from biomass pyrolysis in molten salt.
Dengxiang JI ; Tengyue CAI ; Ning AI ; Fengwen YU ; Hongtao JIANG ; Jianbing JI
Chinese Journal of Biotechnology 2011;27(3):475-481
In order to investigate the effects of pyrolysis conditions on bio-oil production from biomass in molten salt, experiments of biomass pyrolysis were carried out in a self-designed reactor in which the molten salt ZnCl2-KCl (with mole ratio 7/6) was selected as heat carrier, catalyst and dispersion agent. The effects of metal salt added into ZnCl2-KCl and biomass material on biomass pyrolysis were discussed, and the main compositions of bio-oil were determined by GC-MS. Metal salt added into molten salt could affect pyrolysis production yields remarkably. Lanthanon salt could enhance bio-oil yield and decrease water content in bio-oil, when mole fraction of 5.0% LaCl3 was added, bio-oil yield could reach up to 32.0%, and water content of bio-oil could reduce to 61.5%. The bio-oil and char yields were higher when rice straw was pyrolysed, while gas yield was higher when rice husk was used. Metal salts showed great selectivity on compositions of bio-oil. LiCl and FeCl2 promoted biomass to pyrolyse into smaller molecular weight compounds. CrCl3, CaCl2 and LaCl3 could restrain second pyrolysis of bio-oil. The research provided a scientific reference for production of bio-oil from biomass pyrolysis in molten salt.
Biofuels
;
analysis
;
Bioreactors
;
microbiology
;
Catalysis
;
Chlorides
;
chemistry
;
Lanthanum
;
chemistry
;
Lipids
;
biosynthesis
;
Oryza
;
metabolism
;
Plant Stems
;
metabolism
;
Potassium Chloride
;
chemistry
;
Salts
;
chemistry
;
Zinc Compounds
;
chemistry