1.Research on physician-patient disputes within Scope of Media Sociology
Wu-Lin YI ; Ai-Yong LU ;
Chinese Medical Ethics 1994;0(06):-
This paper mainly discusses how physician - patient disputes are included within scope of the media and become its"focus"of concern.It has revealed in my research that the dual interests of the media,the interests driving of the journalists,the strength of TV (or video) and the audiences are the inherent dynamisms which ehance the media let physician - patient disputes included in its vision.In other words,the physician - patient disputes become the"hot spot"of media attention with the help of the gatekeepers and the audiences.
3.The inhibitory effect and molecular mechanism of delphindin on HER-2 positive breast cancer
Tianjin Medical Journal 2018;46(9):910-915
Objective To investigate the inhibitory effect and molecular mechanism of delphinidin (Dp) on HER-2
positive breast cancer. Methods The HER-2 positive breast cancer cells (MDA-MB-453 and BT-474) were treated with
different concentrations of delphinidin (10,20,40,80 and 160 μmol/L) for 48 hours. The same concentration of DMSO was
used as the solvent control. CCK-8 method was used to measure the effect of Dp on cell activity, and half maximal inhibitory
concentration (IC50) was calculated to determine the concentration of subsequent experiments. The cells were treated with
different concentrations of Dp (20, 40 and 80 μmol/L) for 48 hours. HE staining was used to observe the cell morphological
changes. Flow cytometry was used to analyze the cell cycle. Cell apoptosis rate was detected by TUNEL assay. The
phosphorylation levels of NF - κB signaling pathway related proteins were determined by Western blot assay. Results
Delphinidin inhibited the proliferation of MDA-MB-453 and BT-474 in the concentration ranges of 10,20,40,80 and 160 μmol/L (IC50: 41.02 and 60.97 μmol/L). In the concentrations of 20,40 and 80 μmol/L, compared with the control group, it
was found that some cells were detached, floated and lysed, and the cell volume was decreased, the proportion of cells in G2/
M phase and the apoptosis rate were increased in DP treatment groups. Compared with the control group, the expression
levels of p-NF-κB/p65, p-IκBα, p-IKKα/β and p-PKCα were significantly decreased in the 40 and 80 μmol/L Dp
treatment groups, while the expression levels of IκBα, IKKα, IKKβ and PKCα were increased in the Dp treatment groups
(P<0.05). Conclusion Delphinine can inhibit the proliferation of breast cancer cells by blocking the NF-κB signaling
pathway and inducing the G2/M cycle arrest and apoptosis of MDA-MB-453 and BT-474 cells.
Key words:receptor, epidermal growth factor; antineoplastic agents, phytogenic; breast neoplasms; cell cycle;
delphinidin;HER-2 positive breast cancer; NF-κB signaling pathway
4.A case of primary hypertrophic osteoarthropathy with literature review
Xue LIN ; Li MA ; Maixing AI ; Donghai WU
Chinese Journal of Rheumatology 2008;12(4):263-265,插2
Objective To improve the understanding and diagnosis of primary hypertrophic os-teoathropathy(PHO).Methods A case of PHO was reported.The clinical data and the process of the diagno-sis and treatment was analyzed retrospectively,and the related literature were reviewed.Results The patient was a young man without family history of PHO.He had symptoms since age 16.He had clubbing fingers and toes,hypertrophic skin,joint swelling,hyperhidrosis and radiographic evidence of periostitis.Thus the disease was diagnosed as PHO.The patient was treated with NSAIDs and the symptoms relieved very quickly.Conclusion Radiographic examination should be taken in time when young males have the general characters of clubbing fingers and toes,hypertrophic skin changes.If the periostitis presents,the final diagnosis of PHO can be confirmed.
5.Effects of nuclear factor-?B on cell apoptosis and left ventricular segmental function in acute myocardial ischemia-reperfusion
Ping LIN ; Wei-Dong REN ; Zhao-Hui WANG ; Chang-Hong LIU ; Jun WU ; Yue-Ai WANG ;
Chinese Journal of Emergency Medicine 2006;0(09):-
Objective To probe the effects of nuclear factor kappa B (NF-?B) on cell apoptosis and left ventricular segmental function in acute ischemia repeffusion in dogs.Method Twenty-four dogs were randomly divided into three groups:without left anterior artery (lAD) ligation group (C group),LAD was occluded 30 min following reperfusion 120 minutes in isehemical reperfusion group (IR group),and dogs were administered with PDTC before LAD ligation in ischemical reperfusion plus pyorrole dithitocarbamate group (PDTC group).The left ventricular segmental function was detected by echo cardiography using strain rate anlysis software.EF measured by Simpson's method.Cardiac myocyte apoptosis numbers were determined by terminal deoxynudeotidy transferease-mediated biotinylated deoxyuridine triphosphate nick end labeling (TUNEL).lmmunohistochemistry and western-blot anylysis of NF-?B protein expression.Results NF-?B was obviously expression on injury myocardium of IR group,and increased significantly in contrast to control group (P0.05)Conclusions NF-?B might play an important role in acute myocardial ischemia reperfusion.PDTC reduces myocardial iscbemia/repeffasion injury by preventing expression of factor NF-?B.
6.Influential factors related to metabolic syndrome on the outcome of non-diabetic subjects in a community of Shanghai by two-year follow-up
Xiao-Min SONG ; Qi-Lin JIN ; Pei-Ying WU ; Ai-Rong WANG ; Qing-Xiang FEI ;
Chinese Journal of Endocrinology and Metabolism 2001;0(05):-
Objective To investigate the influence of factors related to metabolic syndrome(MS)on the outcome in subjects without diabetes mellitus in a community.Methods A two-year follow-up study was conducted in 885 subjects who were enrolled in the epidemiologic survey carried out in Pingliang Community, Shanghai in 2002.Oral glucose tolerance test,lipid prefde,blood pressure(BP),body mass index(BMI),waist and hip circumferences were measured.Results (1)The baseline of BMI,fasting plasma glucose(FPG),2h plasma glucose after glucose loading(2hPG),BP,triglyceride(TG)in the subjects with impaired glucose regulation(IGR)increased significantly as compared to those with normal glucose regulation(NGR)(all P
7.Influence of liquid nitrogen cryopreservation to survive capability of Babesia microti standard strain
Yuchun CAI ; Jiaxu CHEN ; Yan LU ; Lin AI ; Fen WU ; Shaohong CHEN
Chinese Journal of Zoonoses 2017;33(7):583-587
We discussed the influence of liquid nitrogen cryopreservation to survive capability of Babesia microti standard strain.The whole blood of mice infected with Babesia microti was put in liquid nitrogen to cryopreservation for 1 month,3 months,6 months,9 months,the whole blood was get out respectively and recovery at room temperature,and infected 3 mice respectively,100 μL/ mouse (the first generation after redissolution,the experiment group).In the same time,3 mice were also infected with Babesia microti as the animal conservation control group.When the infection rate was at a high level,the whole blood of the experiment group mice were injected into 3 normal BALB/c mice (the second generation after redissolution),to observe the changes of the Babesia microti form and proliferation situation,and also to observe the infection rate of the first and the second generation after redissolution in different conserving time.Compared with Babesia microti of animal subcultivation,the form of Babesia microti of liquid nitrogen cryopreservation changed a little.Small trophozoites,annular trophozoites,schizont and immature and mature merozoite and other form can also be seen.Compared with Babesia microti of animal subcultivation,the first time to see the worms and the time attaining to the high infection level were 1 to 2 days later,but for the second generation after redissolution,it is the same.There was no significant difference in different conserving time of 1,3,6,9 months.The influence of liquid nitrogen cryopreservation to survive capability and worm form of Babesia microti is a little,so liquid nitrogen cryopreservation can be a better way to conserving Babesia microti.
8.Nursing care of difficulty in decannulation of PICC in 1 case of very low birth weight infant
Na LIN ; Yanfang XU ; Jin′ai HE ; Lilan HE ; Qianling LI ; Wenli WU ; Yanling SONG
Chinese Journal of Practical Nursing 2016;32(31):2449-2450
Objective To summarize the nursing experience of 1 case of very low birth weight infant decannulation difficult in PICC. Methods The nursing key points included: full assessment analysis decannulation difficult reason, consult the PICC catheter outpatient health nurses, give magnesium sulfate hydropathic compress, mucopolysaccharide polysulfate cream local besmear outside, sanyrene outside, at the same time give low-molecular-weight heparin calcium injection subcutaneous injection such as anticoagulant active treatment and nursing. Results After 7 days ,the infant left axillary mass dispel, PICC pull out smoothly. Conclusions Decannulation difficult of very low birth weight infant requires full evaluation, multidisciplinary cooperation and specialist consultation, can give targeted personalized nursing safety smooth tube drawing, is worthy of reference for clinic.
9.The dignostic value of serum vitamin B12 in predicting rebleeding in patients with liver cirrhosis of esophagogastric varices
Siyu JIANG ; Qiuyan LIN ; Yingjie AI ; Ling WU ; Xiaoquan HUANG ; Shiyao CHEN
Journal of Chinese Physician 2021;23(3):343-346
Objective:The aim of this study was to investigate the prognostic value of vitamin B12 as the non-invasive biomarker to predict long-term rebleeding rate in cirrhotic patients with esophagogastric varices.Methods:From Dec 1, 2016 to Dec 31, 2017, cirrhotic patients with esophagogastric varices who had been admitted to Zhongshan Hospital affiliated to Fudan University were enrolled. All these patients received endoscopic treatment to prevent variceal rebleeding. The serum vitamin B12 and folic acid levels were measured in all of them. The receiver operating characteristic (ROC) analysis, Kaplan-Meier analysis, univariate and multivariate cox regression analysis were conducted to explore the value of vitamin B12 in predicting 3-year variceal rebleeding in cirrhotic patients with esophagogastric varices after endoscopic treatment.Results:115 patients were included. The ROC curve analysis indicated that the optimal cutoff value of vitamin B12 for 3-year variceal rebleeding was 567.25 pg/ml. According to the cut-off value, the patients were divided into high-level vitamin B12 group ( n=49) and low-level vitamin B12 group ( n=66). Compared with the low vitamin B12 group, the high vitamin B12 group had lower albumin level, less male (63.3% vs 80.3%), and higher 3-year rebleeding rate ( P<0.05). Cox analysis showed that vitamin B12 and platelet were independent prognostic factors for 3-year rebleeding in patients with variceal bleeding. Conclusions:Elevated peripheral blood vitamin B12 predicts a higher risk of long-term rebleeding in patients with liver cirrhosis and esophagogastric varices.
10.Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis
Zhu JI-TING ; Lin HAN ; Wu XUAN ; Li ZHI-WEN ; Lin AI-YU
Chinese Medical Journal 2019;132(23):2827-2834
Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATITA-GAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOV A)in R software.Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each <1.41%).ITS genotype was 4efined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P = 0.0014)between infectious group and control group was observed.Conclusions: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.